ID: 912405135

View in Genome Browser
Species Human (GRCh38)
Location 1:109431319-109431341
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912405135_912405138 8 Left 912405135 1:109431319-109431341 CCTAGCACAAGGTGGTGACCCAG No data
Right 912405138 1:109431350-109431372 GATTTTCATCAATGTTGACCTGG No data
912405135_912405139 9 Left 912405135 1:109431319-109431341 CCTAGCACAAGGTGGTGACCCAG No data
Right 912405139 1:109431351-109431373 ATTTTCATCAATGTTGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912405135 Original CRISPR CTGGGTCACCACCTTGTGCT AGG (reversed) Intergenic
No off target data available for this crispr