ID: 912405531

View in Genome Browser
Species Human (GRCh38)
Location 1:109434502-109434524
Sequence GTCCCATCTGGGGCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912405531_912405542 16 Left 912405531 1:109434502-109434524 CCCCTTTTAGCCCCAGATGGGAC No data
Right 912405542 1:109434541-109434563 CAAGACTGCACAAAGCAGCAAGG 0: 48
1: 95
2: 189
3: 278
4: 701
912405531_912405543 22 Left 912405531 1:109434502-109434524 CCCCTTTTAGCCCCAGATGGGAC No data
Right 912405543 1:109434547-109434569 TGCACAAAGCAGCAAGGCCCTGG 0: 106
1: 186
2: 223
3: 373
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912405531 Original CRISPR GTCCCATCTGGGGCTAAAAG GGG (reversed) Intergenic
No off target data available for this crispr