ID: 912406593

View in Genome Browser
Species Human (GRCh38)
Location 1:109443812-109443834
Sequence CTCTGAACACCAAGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912406589_912406593 3 Left 912406589 1:109443786-109443808 CCTACGTAAGGAAATCCCTGTAA No data
Right 912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912406593 Original CRISPR CTCTGAACACCAAGGCTCAG AGG Intergenic
No off target data available for this crispr