ID: 912408070

View in Genome Browser
Species Human (GRCh38)
Location 1:109458654-109458676
Sequence AAACTAGCTCCTGTTAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912408069_912408070 -8 Left 912408069 1:109458639-109458661 CCTTCTTAGTGTCTCAAACTAGC No data
Right 912408070 1:109458654-109458676 AAACTAGCTCCTGTTAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912408070 Original CRISPR AAACTAGCTCCTGTTAAGAT AGG Intergenic
No off target data available for this crispr