ID: 912408632

View in Genome Browser
Species Human (GRCh38)
Location 1:109464722-109464744
Sequence TTATCCCTATTCCATAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912408632 Original CRISPR TTATCCCTATTCCATAGAAC AGG Intergenic
900073626 1:794004-794026 TTATCCCAAATGCTTAGAACTGG - Intergenic
901119702 1:6881035-6881057 TTATCCCCATTTCATAGACAAGG + Intronic
901156089 1:7140056-7140078 TTATCTCCATTCTGTAGAACAGG + Intronic
901227613 1:7623331-7623353 TTACCCCTACTCTATAGAAGAGG + Intronic
903174259 1:21571233-21571255 TTATCCCTACTTTATAGAAGAGG - Intronic
903241991 1:21989106-21989128 TTATCCCTACTACATAGAGGAGG + Intronic
903267374 1:22165922-22165944 TAATCCCCACTCCATAGGACTGG - Intergenic
903300866 1:22377904-22377926 TTATCCCCATTTCATAGACGAGG - Intergenic
903363983 1:22794655-22794677 TCATCCCTATTTCACAGAAGAGG + Intronic
903707243 1:25295263-25295285 TTATCCCCATTCTATAGATAGGG - Intronic
903719997 1:25398079-25398101 TTATCCCCATTCTATAGATAGGG + Intronic
904163094 1:28535734-28535756 TTATCCCTATTTTATAGAAAAGG - Intronic
906808792 1:48805474-48805496 TTATCCCTGTTCCATAGTTGAGG - Intronic
907474235 1:54694952-54694974 TTATCCCCATTTCATAGATGAGG - Intronic
907700953 1:56787684-56787706 TTATCCCTATTTTATAGATAAGG + Intronic
907731100 1:57066804-57066826 TTATCCCCATTTCATAGCCCAGG + Intronic
907824572 1:58003112-58003134 TTACCCCTGTTTCATAGACCAGG - Intronic
907865996 1:58399764-58399786 TTATCCCTATTTTACAGAAGGGG + Intronic
907884698 1:58582049-58582071 TTATCCCTATTTTATAGATGTGG + Intergenic
907956792 1:59236200-59236222 TTGTTCCCATTCCATAGAAAAGG - Intergenic
909358484 1:74734737-74734759 TTATCCTCAGTTCATAGAACAGG - Intronic
909935457 1:81545677-81545699 TTATCCCCATTATATAGAACAGG + Intronic
910406197 1:86893112-86893134 TTATCCCTATTTAATAGAAGAGG - Intronic
910418208 1:87024614-87024636 TTATCCCTATTTCATAGTTAAGG - Intronic
910598822 1:89008616-89008638 TTATCCCTATTACTTAGGAGAGG - Intronic
911053756 1:93693997-93694019 TTATCCCTATTTTATAGATGAGG + Intronic
911707577 1:101031587-101031609 TTATCTCTATTTTATAGAATAGG - Intergenic
912408632 1:109464722-109464744 TTATCCCTATTCCATAGAACAGG + Intergenic
912755756 1:112323768-112323790 TTATCCTTATTCCATAAATGGGG - Intergenic
912839589 1:113027283-113027305 TTATCCCTATTTTATAGAAACGG - Intergenic
913247746 1:116885084-116885106 TTATCCCTATTCTATGAAAGAGG - Intergenic
913724033 1:121632555-121632577 TTATCCCTTTTCCATCGAAATGG + Intergenic
913724200 1:121634421-121634443 TTATCCCTTTTCCATCGAAATGG + Intergenic
913724530 1:121638159-121638181 TTATCCCTTTTCCATCGAAATGG + Intergenic
913724697 1:121640028-121640050 TTATCCCTTTTCCATCGAAATGG + Intergenic
913737698 1:121804132-121804154 TTATCCCTTTTCCATCGAAATGG + Intergenic
913740953 1:121843809-121843831 TTATCCCTTTTCCATCGAAATGG + Intergenic
913741448 1:121849586-121849608 TTATCCCTTTTCCATCGAAATGG + Intergenic
913757410 1:122091818-122091840 TTATCCCTTTTCCATCGAAATGG - Intergenic
913758222 1:122101154-122101176 TTATCCCTTTTCCATCGAAATGG - Intergenic
913759717 1:122118750-122118772 TTATCCCTTTTCCATCGAAATGG - Intergenic
914890466 1:151617761-151617783 TTATCCCTATTTTATAAGACAGG + Intronic
917973601 1:180224573-180224595 TTATCCCTATTCTACAGATGAGG - Intergenic
918433599 1:184487419-184487441 TTATCCCTACTTGATAGAAGGGG + Intronic
918549563 1:185726701-185726723 TGATCCCCATTTCATAGAAGAGG - Intergenic
920989496 1:210923114-210923136 TTCTCCCTATTCCATATTCCAGG - Intronic
922269486 1:224018911-224018933 TTATCCCAAATGCTTAGAACTGG - Intergenic
924185256 1:241482168-241482190 TTTTCACTATTTCACAGAACTGG - Intergenic
1064846076 10:19655059-19655081 TGATTCTTATTCCATAGAACAGG - Intronic
1066535629 10:36387989-36388011 TTATCCCTATTTTATACAAGAGG + Intergenic
1066584836 10:36921171-36921193 TTATCCCCATTCTATAGACAAGG + Intergenic
1067769676 10:49114515-49114537 TTATCCCTATTTTATAGATGAGG - Intronic
1068160436 10:53255727-53255749 TTATCCCTATTTTATGGAAGAGG + Intergenic
1068773810 10:60850496-60850518 TTATCCATGGTCCATACAACTGG - Intergenic
1068834148 10:61533706-61533728 TTATCCCTATTTTATAGATAGGG - Intergenic
1069087754 10:64161107-64161129 TTATCCCTATTTTATAGAATTGG - Intergenic
1070105612 10:73428033-73428055 ATATCCCTTTTCCATAGAGCTGG + Intronic
1070607261 10:77907690-77907712 TTATCCCCATTCCACAGATGAGG + Intronic
1071170609 10:82859295-82859317 TTTTCCATATCCCATAGACCAGG + Intronic
1072015610 10:91343494-91343516 TTATCCCTATTTTATAGAGCAGG + Intergenic
1072303736 10:94086857-94086879 TTATCTCTATTCCACAGATGAGG - Intronic
1072517792 10:96202895-96202917 TTATGCCCATTTTATAGAACAGG + Intronic
1073274555 10:102298689-102298711 TTATCCCCATTGTATAGAAGAGG + Intronic
1074449711 10:113549304-113549326 TTATCCCTATTTTATAGATGAGG + Intergenic
1075279688 10:121129002-121129024 TTATCCCCATTTTATAGAAGTGG + Intergenic
1075829850 10:125399438-125399460 TTATCCAAATTCCACTGAACCGG + Intergenic
1076540800 10:131213575-131213597 TTGTCCCCATTCCATAGACGGGG - Intronic
1078319152 11:10318275-10318297 TTATCCCTAACCAATTGAACTGG + Intronic
1078568323 11:12436157-12436179 TTATCCCTAATCCTCAGAAGAGG - Intronic
1078838796 11:15058114-15058136 TTATCCCTATTTTACAAAACAGG + Intronic
1079326756 11:19499637-19499659 TTATCCCTATTTAATAGACAGGG - Intronic
1079488728 11:20963493-20963515 TTAACCCTATTCAATAAAATAGG + Intronic
1080236195 11:30071085-30071107 TTATCTCTATTCCTTAAAATGGG - Intergenic
1080809051 11:35684553-35684575 TTATCACTATTTTATAGAAGGGG + Intronic
1083629585 11:64088698-64088720 TTATCCCCATTTCATAGACAGGG - Intronic
1085399092 11:76224904-76224926 TCATCCCCATTCCACAGGACAGG + Intergenic
1085401305 11:76237420-76237442 TTATCCCCATTTCACAGATCAGG + Intergenic
1085862225 11:80247601-80247623 TTATCCCCATTCTATAGATGAGG + Intergenic
1087122850 11:94592905-94592927 TTATCCTTATTTCATAGATGAGG + Intronic
1087595788 11:100253447-100253469 TTATCCCCATTTCATAGAGGAGG - Intronic
1087638777 11:100733221-100733243 TTATCCCTATTTCATAGATAAGG - Intronic
1088363905 11:109019039-109019061 TTATCCCCATTCAATAGAGTAGG + Intergenic
1090960046 11:131548085-131548107 TTATCCCTATTTCACAGTTCTGG - Intronic
1091981899 12:4871332-4871354 TAAGCCATATTCCATAGGACAGG - Intergenic
1092510762 12:9153671-9153693 TTATCACTCTTCCATCTAACTGG - Intronic
1093338985 12:17948518-17948540 TTATCCCTATTCCAATGAATAGG + Intergenic
1093952508 12:25179905-25179927 TCATTCCTATTCAATAGTACTGG + Intronic
1094474555 12:30831388-30831410 TTAACCCAATTTCATAGAAAGGG - Intergenic
1095335202 12:41016137-41016159 TTATCCCTAGCACCTAGAACAGG - Intronic
1095339674 12:41074880-41074902 TTATCCCTATTTTACAGAAGAGG - Intergenic
1096033351 12:48441054-48441076 TTATTCCTATTTCAGAGAAGAGG - Intergenic
1097606602 12:61762386-61762408 TTATTCCTTTTCCAAAGAATTGG + Intronic
1097624632 12:61984908-61984930 TTATTTCTATTCCAAAGCACAGG - Intronic
1097680889 12:62647856-62647878 TTATTCCCCTTCCACAGAACAGG - Exonic
1098998457 12:77148934-77148956 TTATCCCTATTTTACAGATCAGG - Intergenic
1100461215 12:94801306-94801328 TTATCCCCATTCTATAGATGAGG + Intergenic
1100508968 12:95249878-95249900 TTATTCCAATTCCATAGATGAGG - Intronic
1101261059 12:103030610-103030632 TTATCCCTATTCAACAGACAAGG + Intergenic
1101652904 12:106693971-106693993 TTATCCCCATTTCACAGAAGGGG + Intronic
1102633962 12:114306339-114306361 TTATCCCCATTCTATAGAAAAGG + Intergenic
1102852481 12:116261777-116261799 TTATAAATATGCCATAGAACAGG - Intronic
1102973810 12:117191577-117191599 TTATACCTATTCTACAGAAAAGG + Intergenic
1103344450 12:120240093-120240115 TTATACCTATTCTATAGATGAGG - Intronic
1104613002 12:130244837-130244859 TTATCCCCATTTCATAGATCAGG + Intergenic
1104997784 12:132669562-132669584 TAACATCTATTCCATAGAACAGG + Intronic
1106742996 13:32667112-32667134 TTAAACATATTCCAGAGAACAGG - Intronic
1109057011 13:57563467-57563489 TTATCCCTATTCCATAGGTTAGG - Intergenic
1109183036 13:59236579-59236601 TTATCCAGATGCCATAGATCAGG - Intergenic
1110036636 13:70694405-70694427 TAATCCCCATTCTCTAGAACAGG - Intergenic
1112347612 13:98603637-98603659 TTATCACTATTGAATAAAACAGG - Intergenic
1113016290 13:105832144-105832166 TTATCCCTCTTCCATAGCCTTGG + Intergenic
1114000964 14:18244959-18244981 TTAACCTTATTTCATAGAGCAGG - Intergenic
1114502665 14:23182657-23182679 TTCTTCCTATTCCTTAGAAAAGG - Intronic
1115347074 14:32354397-32354419 TTATCCCCATTTCACAGAATGGG - Intronic
1115502622 14:34062990-34063012 TTATCCCCATTTCACAGAAGAGG - Intronic
1118138083 14:63049676-63049698 TTATCCCCATTTTATAGAAAGGG - Intronic
1118177524 14:63456454-63456476 TTATCCTTATTCCACTGGACAGG - Intronic
1118325355 14:64776872-64776894 TTGTCCCTATTACCTAGACCAGG - Intronic
1118624363 14:67644319-67644341 TTATCCCTATCTCACAGAAAAGG + Intronic
1119022963 14:71130451-71130473 CCATCCCTATTCCATAGAGATGG - Intergenic
1121082221 14:91117528-91117550 TTATCCCTATTTTACAGAAAAGG - Intronic
1121496153 14:94392414-94392436 TTATCCCTATTTTATAGATGAGG - Intergenic
1121498529 14:94414993-94415015 TCATCCCTATTCTACAGAAGAGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122574981 14:102736277-102736299 TTATCTCTGTTCTATAGAAGAGG + Intergenic
1123189495 14:106555363-106555385 TAAGCCCTTTTCCATGGAACAGG - Intergenic
1123925767 15:25109052-25109074 GTATACTTATTCCACAGAACAGG - Intergenic
1127129238 15:55844611-55844633 TTATCCCTATTTTATAGATGAGG - Intronic
1127387537 15:58478595-58478617 TTATCCCCATTTCATAGAGGAGG + Intronic
1127693515 15:61421199-61421221 TTATCCCCATTTAATAGAAAAGG + Intergenic
1129372838 15:75108906-75108928 TTATCCCTATTCAATTGATGAGG + Intronic
1129691459 15:77716096-77716118 TTATCTCTATTTTATAGAAGGGG + Intronic
1130152616 15:81323014-81323036 TTACCCCTCTTCTGTAGAACAGG - Intronic
1134745640 16:16586083-16586105 TTATACCTATTTTATAGAAGAGG + Intergenic
1134999838 16:18767664-18767686 TTATACCTATTTTATAGAAGAGG - Intergenic
1135663413 16:24316076-24316098 TTATCCCTATTTCACAGAGGAGG + Intronic
1138896558 16:61212596-61212618 TTATCTCTATTTCATAGAGATGG + Intergenic
1140710267 16:77670996-77671018 TCATCCCTGTTCCATAAAAAAGG - Intergenic
1141269302 16:82524247-82524269 TTACATTTATTCCATAGAACTGG + Intergenic
1141323925 16:83037836-83037858 TTATCCCTATTTGATAGATGAGG - Intronic
1144966410 17:19079338-19079360 TTATCCCCGTTCCACAGAAGGGG - Intergenic
1144981508 17:19172719-19172741 TTATCCCCGTTCCACAGAAGGGG + Intergenic
1144986716 17:19205520-19205542 TTATCCCCGTTCCACAGAAGGGG - Intergenic
1145097769 17:20046452-20046474 TTATCCCTAGGACATAGAACAGG - Intronic
1146323725 17:31867588-31867610 TAATCCCTTTTCCATAGAGCTGG - Intronic
1147039516 17:37707592-37707614 TTATCCCTATTTCATAGAGAAGG + Intronic
1149893777 17:60413235-60413257 TTATCCCTGTGTTATAGAACTGG + Intronic
1150850895 17:68702781-68702803 TTATCCCTGTTTTATAGAAGAGG - Intergenic
1153155255 18:2141805-2141827 TTATCCCTATTTCATAGTTGAGG - Intergenic
1154373436 18:13787412-13787434 TTATACCTACTTCATAGGACTGG + Intergenic
1155111253 18:22716741-22716763 TTATTCCTAATGCCTAGAACAGG + Intergenic
1155583102 18:27334434-27334456 TTATTCCCATTTTATAGAACAGG + Intergenic
1155933467 18:31730286-31730308 TTATCTCTATACAATAGAAGAGG - Intergenic
1156341826 18:36216325-36216347 TTATCCCTATTTTATAGATATGG + Intronic
1156665047 18:39394599-39394621 TTATTCCTATTCCATAAGAATGG - Intergenic
1157212593 18:45756676-45756698 GTATCCCTATTCAACAGCACTGG + Intergenic
1158149831 18:54355954-54355976 TTATCCCCATTCTATAGATATGG - Intronic
1158289353 18:55921320-55921342 TTATCCCTATTGCACAGATGAGG - Intergenic
1159433710 18:68387617-68387639 TTATCCATATTACATAGATGAGG + Intergenic
1160965356 19:1744897-1744919 TTATCCCCATTCCACAGATGGGG + Intergenic
1162156943 19:8684630-8684652 TTATCCCCATTCTGTAGAAGAGG - Intergenic
1163601931 19:18254557-18254579 TTATCCCCATTTCATAGCTCAGG - Intronic
1166007850 19:39919432-39919454 TTATCCCCAGTGCATAGAACAGG + Intronic
925983184 2:9193332-9193354 ATTTCTCTATCCCATAGAACAGG - Intergenic
926410272 2:12595632-12595654 TTGTCCCCATGCCATAGAAAAGG + Intergenic
926451220 2:13006706-13006728 CTCTCCCTATTAAATAGAACTGG + Intergenic
928872521 2:35997477-35997499 TTATTCCTTTTCCATGGAGCTGG - Intergenic
929153250 2:38767219-38767241 TTATCCCTATTCTATAGCCAAGG - Intronic
929180072 2:39028675-39028697 TAAAACCTATTCCATAGAACAGG + Intronic
929378818 2:41324562-41324584 TTTTCCCCATTCCTTAAAACTGG + Intergenic
929439950 2:41957606-41957628 TTATCCCCATTCTATAGATGAGG + Intergenic
929870130 2:45752254-45752276 TTATCCCCATTTTACAGAACAGG + Intronic
930064535 2:47317577-47317599 TTATCCCCATTTCATAGATGAGG - Intergenic
931082704 2:58793229-58793251 TTATCCCAATTCTACAGATCAGG + Intergenic
931224186 2:60315515-60315537 TTATCCCCATTTCATAGATGAGG + Intergenic
932478792 2:72025672-72025694 TTATCCCCATTCCACAGATGAGG - Intergenic
932822147 2:74910804-74910826 ATATCCTCATTTCATAGAACAGG - Intergenic
933275354 2:80278111-80278133 ATATCCCTACTTCATAGAAGAGG - Intronic
938646939 2:133341616-133341638 TTATCCATATTTCATAATACTGG + Intronic
938761795 2:134432750-134432772 TTATCCCTATTTCTCAGAAGAGG - Intronic
938830356 2:135044207-135044229 TTATCCCTATTCTATAGATGAGG + Intronic
939519734 2:143214773-143214795 TTATTCCTAATACATAGCACGGG - Intronic
940708722 2:157135942-157135964 TTATCCCCATTTTATAGATCAGG - Intergenic
941618796 2:167753897-167753919 TTATCCCTATTGAATAAAGCAGG - Intergenic
941835705 2:170017930-170017952 TTATCTCTTTTTCATAGAAAAGG + Intronic
942414385 2:175743444-175743466 TTATCCCCATTTCATAGATGAGG - Intergenic
945235761 2:207629943-207629965 TTATCCCTATTTTATAGATGAGG - Intergenic
946299133 2:218811885-218811907 TTATCCCCATTTTATAGAAAGGG + Intronic
946346181 2:219112321-219112343 TTATCCCTATTTTATAGATGAGG - Intronic
947192370 2:227520656-227520678 TAGTCCCTATTCCATAGCAAGGG - Intronic
947786190 2:232822702-232822724 CAATTCCAATTCCATAGAACTGG - Intronic
947914286 2:233821691-233821713 GTCTCCCTATTCCACAGAAGAGG - Intronic
1171025815 20:21629540-21629562 TTACCCCTATTCCATAGACAAGG - Intergenic
1171169146 20:23000083-23000105 TTATCCCCATTTTATAGAAGAGG - Intergenic
1172906326 20:38372597-38372619 ATGTCCCTATTCCATATATCGGG - Intronic
1173126170 20:40338040-40338062 TTATCCCAATCCCAAGGAACAGG + Intergenic
1177324507 21:19567141-19567163 TTATCACAGTTCCATAGACCTGG - Intergenic
1178416917 21:32412169-32412191 TTATCGCCATTCCACAGAAGAGG - Intronic
1178602281 21:34004995-34005017 TTATCCATATTCATTAAAACTGG - Intergenic
1179031871 21:37727604-37727626 CTATCCCTCTTCCTTATAACCGG - Intronic
1179039581 21:37790496-37790518 TTATCCCCATTTCATAGATAAGG + Intronic
1180425475 22:15175757-15175779 TTAACCTTATTTCATAGAGCAGG - Intergenic
1181978804 22:26751808-26751830 TTATCCCTATTTTATACAAGAGG - Intergenic
1183377382 22:37473078-37473100 TTATCCCCATTCTATAGATGGGG - Intronic
1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG + Intronic
949645962 3:6094335-6094357 TTATCCCTATTGTACAGATCGGG - Intergenic
950076367 3:10190031-10190053 TTATCCCTATTTTATAGAAGAGG + Intronic
950792968 3:15487984-15488006 TTATCCCCATTGCATAGATGAGG + Intronic
952010170 3:28891619-28891641 TTATCCCCATTTCATAGACGAGG + Intergenic
953042036 3:39264372-39264394 TTATCCCTCTTCTACAGACCAGG + Exonic
955526675 3:59827598-59827620 GTATCCCTATTTTATAGAAGAGG + Intronic
956429985 3:69176861-69176883 TTATCCCTACTCTATAGATGAGG - Intronic
957220653 3:77378345-77378367 TTATCCCCATTTTATAGAATGGG + Intronic
957244411 3:77700002-77700024 TGATTCCTCTTCCATAAAACGGG - Intergenic
958653894 3:96976775-96976797 TTATTTCTATACCATAGCACAGG + Intronic
958753223 3:98218017-98218039 TTTTACCTATTCTAGAGAACAGG - Intergenic
959487577 3:106945075-106945097 TTATCCCCAGCACATAGAACTGG + Intergenic
960698474 3:120418259-120418281 TTAACCCTATTCCATAGATGAGG + Intronic
966600645 3:181771868-181771890 TTATTCCCATTTTATAGAACAGG - Intergenic
968228167 3:196988958-196988980 TTATCCCCATTCTACAGGACTGG - Intronic
969129474 4:4981072-4981094 TTCTCCCTCTTCCAGAAAACTGG + Intergenic
969339666 4:6532239-6532261 TCATCCCCAGTCCATAGAAGGGG + Intronic
970466226 4:16325599-16325621 TTATCCCTATTACATCGATAGGG - Intergenic
971213873 4:24645819-24645841 TTATCCCTATTCTACAGATGAGG + Intergenic
971581988 4:28353286-28353308 TTATCTCTATTCTAGAGAAATGG + Intergenic
971621491 4:28859660-28859682 TTATCCCTATTTTATGGAAATGG + Intergenic
971839259 4:31812309-31812331 TTATCCCTATTTCAAAGAAGAGG - Intergenic
975428001 4:74253526-74253548 CTCTCCCTCTTCCATAGAGCAGG - Intronic
976378403 4:84371753-84371775 TTATCCCTATTTCACAGATGAGG - Intergenic
978638905 4:110844845-110844867 TTTTCCCTCTTCCATAGTTCTGG - Intergenic
979192704 4:117882434-117882456 TTATCCCTATTTGATAGAGGAGG + Intergenic
980800472 4:137742595-137742617 TTATTCCCATTTCATAGATCAGG - Intergenic
980823679 4:138048299-138048321 TTGTCCCTATCCCATAGGAATGG - Intergenic
981743733 4:148031405-148031427 TTATCCCTATTTTATAGTTCAGG + Intronic
982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG + Intergenic
984305074 4:177979092-177979114 TTATCTCTATTTTATAGAAGAGG - Intronic
984805726 4:183749565-183749587 TTATCCCTGTTCCCTAGAACTGG - Intergenic
987954748 5:24724057-24724079 TTATGCCTATTTCATAGCATGGG - Intergenic
988721774 5:33886391-33886413 TTATCCCCATTTCATAGATAAGG + Intronic
990344925 5:54862662-54862684 TTATCCCCAGTACCTAGAACTGG + Intergenic
990454811 5:55974840-55974862 TTATCACCATTTCATAGATCAGG + Intronic
992498574 5:77318516-77318538 TTATCCCTATTTTATAGACATGG - Intronic
993019709 5:82576967-82576989 TTATCCCTATTCTAAAGATGAGG - Intergenic
993383707 5:87238276-87238298 TCTTCCCTAATCCATATAACTGG + Intergenic
996072364 5:119147840-119147862 TTATCCTTATTCCAGAGCAGTGG + Intronic
996340477 5:122433295-122433317 TTATCCCCATTTCATAGATGAGG + Intronic
996538206 5:124601005-124601027 TTATCCTCATTTCATAGAAAAGG - Intergenic
999710851 5:154317054-154317076 CCATCCCTATTCCATAGATAAGG + Intronic
1000843669 5:166252692-166252714 TCATCCCTATTCTATAGATAAGG + Intergenic
1002089355 5:176795265-176795287 TTATCCCCATTCCACAGAGCGGG - Intergenic
1003133035 6:3412007-3412029 TTATCCCCATTTCACAGACCAGG - Intronic
1006570048 6:34995037-34995059 TTATCATTCTTCCTTAGAACAGG - Intronic
1006909260 6:37553431-37553453 TTATCCCTATTTTATAGACATGG - Intergenic
1007833171 6:44654330-44654352 TTATCCCTATTACCTAGATGAGG - Intergenic
1008497662 6:52149546-52149568 TTATCCCTATTCTACAGATCAGG - Intergenic
1008543353 6:52564719-52564741 TTATCCCTAGCCCCAAGAACAGG + Intronic
1008917639 6:56806824-56806846 TTATCCCTATTTTATAGACAAGG + Intronic
1009789648 6:68385498-68385520 TTATCTCAATCACATAGAACAGG - Intergenic
1011453679 6:87523899-87523921 TAATCCCAATTGCATAGAAATGG + Intronic
1011766033 6:90621374-90621396 TTGTCCCTATTTTATAGAAGAGG + Intergenic
1014398349 6:120954602-120954624 TTATCCCTATTTTATAGATGAGG + Intergenic
1015109487 6:129575263-129575285 TTATCCTTAATCCATTGAATGGG - Intergenic
1015969950 6:138733801-138733823 CTATACCCAATCCATAGAACTGG + Intergenic
1016975470 6:149803284-149803306 TTCTCCCCATTCTATAGAATAGG + Intronic
1017242299 6:152183781-152183803 TTATCCCCATTCCAGAGACAAGG + Intronic
1017538409 6:155373300-155373322 CTATCCCTAGTGCTTAGAACAGG - Intergenic
1017598202 6:156053002-156053024 TTATCACTAATCGATGGAACGGG + Intergenic
1017683439 6:156887159-156887181 TTGTCCCTATTACCTAGGACAGG - Intronic
1019723027 7:2584819-2584841 TTACCCCTAATCCTTAAAACTGG + Intronic
1020205110 7:6108438-6108460 TTATCCCTACTTCATAGCATGGG + Intronic
1020480661 7:8656419-8656441 TTATCCCCATTACAGAGAAGAGG + Intronic
1021105993 7:16640227-16640249 TTATCCTTATTTCATAGATAAGG - Intronic
1021905844 7:25332381-25332403 TTATCCCTACTCCATGGATATGG + Intergenic
1022570883 7:31453211-31453233 TCATCCCCATTTCATAGAAGAGG + Intergenic
1023709382 7:42975671-42975693 TACTCCCTATTCCACATAACTGG + Intergenic
1024441679 7:49426666-49426688 TTATCCCTATTTCACAGATAAGG - Intergenic
1025954148 7:66169801-66169823 TTATCCCTATGTCATAGAGGAGG + Intergenic
1027422296 7:78028884-78028906 TTATCCCCATTTCAAAGATCAGG + Intronic
1027581118 7:79996862-79996884 TTATCCCCATTCCATGGTTCAGG + Intergenic
1028221894 7:88207168-88207190 TTATCCCTATTTTAGAGAAAAGG + Intronic
1028655163 7:93196609-93196631 TTATCCCTATTATATAGAAGAGG + Intronic
1029915861 7:104208820-104208842 TTATCCCTATTTTATAGATAAGG - Intergenic
1031073849 7:117193454-117193476 TTATCCCTATTACATAGATGAGG + Intronic
1031346709 7:120675587-120675609 TTATACGTATTCCAGAGAATTGG - Intronic
1033308728 7:140243732-140243754 TTATCCCTATTTTATAGATGAGG - Intergenic
1034186806 7:149184355-149184377 TTATCCCTATCCTATAGATAAGG - Intergenic
1034564588 7:151903040-151903062 TTATCACTATTCTGTAGAAGAGG + Intergenic
1035332637 7:158106285-158106307 TTATCCTTATTCCTTACAAGTGG + Intronic
1037330560 8:17739672-17739694 TTATCCCTATTTTATAGACAAGG - Intronic
1037777935 8:21848000-21848022 TTATCCCTATTCCATGGGAAAGG + Intergenic
1039598680 8:38814669-38814691 TATTCCCTATTCCACAGAACAGG + Intronic
1041685031 8:60636103-60636125 TTATAACCATCCCATAGAACAGG - Intergenic
1043778156 8:84296579-84296601 TTTTACCTATTCCCTAGAGCAGG + Intronic
1045008281 8:97935221-97935243 TTATCCCTATTTTACACAACTGG + Intronic
1045217596 8:100163640-100163662 CTATCCCTATTCCTTATCACTGG + Intronic
1045696241 8:104811542-104811564 TTATCCCCATTTTATAGAAAAGG - Intronic
1046127344 8:109926925-109926947 TTATTCCTATTCTATAGAAAAGG - Intergenic
1047013349 8:120696375-120696397 TTATTGCAATTCCATAGAAAAGG + Intronic
1047738448 8:127787563-127787585 TTATTCCCAATCCATTGAACTGG + Intergenic
1047747651 8:127856737-127856759 TTATCCCCATTCAATAGATAAGG + Intergenic
1048441165 8:134459995-134460017 GAATCCCTACTTCATAGAACAGG - Intergenic
1050335814 9:4589146-4589168 TTATTCCTATTTCATGGAAGAGG - Intronic
1052424891 9:28291434-28291456 TTATCCCTGTTCCCTAGAACTGG - Intronic
1052610234 9:30762204-30762226 TTATCCCTATTGCTGAGAAGTGG + Intergenic
1052870055 9:33496460-33496482 TTATCCGTATTTCAGAGAAGAGG + Intergenic
1057885434 9:98826163-98826185 TTATCCCTATTTCACAGATGAGG - Intronic
1057974525 9:99590728-99590750 TAATCTCTAGTGCATAGAACAGG - Intergenic
1060069919 9:120537259-120537281 TTATCCCTATTTTATAGATTGGG - Intronic
1186121899 X:6372412-6372434 TTATCCTTATTTAATAGAAAAGG - Intergenic
1187190025 X:17025644-17025666 TTATCCTTATTCCAAAGCACAGG - Intronic
1189503336 X:41584932-41584954 TTATCTCTATTTCACAGAGCAGG - Intronic
1189656477 X:43250134-43250156 TTATCCCTATTTTATAGATAAGG + Intergenic
1189884084 X:45522322-45522344 TTACCCCTATTCAAGTGAACAGG + Intergenic
1190327698 X:49216712-49216734 TTATCCTTATTTCTTAGAATGGG - Intronic
1191687695 X:63909590-63909612 TTATCCCTATTTTATGGAAGAGG + Intergenic
1194671413 X:96737976-96737998 TTATCCCTATTTCAGAGATGAGG + Intronic
1194914919 X:99694322-99694344 TTATCCCTATTTTATAGATGAGG - Intergenic
1195124653 X:101795162-101795184 TTATCTGTATTTCATAGATCAGG + Intergenic
1196047739 X:111273937-111273959 TTATTCCTATTTTATAGAGCAGG - Intergenic
1196306311 X:114107358-114107380 TTACCCCTATTCAATAGATGAGG - Intergenic
1196719287 X:118839050-118839072 TTGTCCCTATTTTATAGAAGAGG + Intergenic
1197887169 X:131230730-131230752 TTATCCCTATTTTATAGATGAGG + Intergenic
1199759487 X:150894381-150894403 TTATCCCTATTTCACAGATGAGG + Intronic