ID: 912411957

View in Genome Browser
Species Human (GRCh38)
Location 1:109485811-109485833
Sequence ATGCAGCAGGTGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 550}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912411953_912411957 -9 Left 912411953 1:109485797-109485819 CCATCTTAGTCCAGATGCAGCAG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG 0: 1
1: 0
2: 3
3: 49
4: 550
912411949_912411957 26 Left 912411949 1:109485762-109485784 CCATAAGAAAGGTGGATGGATTC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG 0: 1
1: 0
2: 3
3: 49
4: 550
912411948_912411957 27 Left 912411948 1:109485761-109485783 CCCATAAGAAAGGTGGATGGATT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG 0: 1
1: 0
2: 3
3: 49
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912411957 Original CRISPR ATGCAGCAGGTGAAGGAAGA TGG Intronic
900004979 1:39211-39233 AGGCAGCAGGGGAAGGATGAAGG - Intergenic
900311054 1:2033303-2033325 AGGCCGCAGGTGGAGCAAGAGGG + Intergenic
900698677 1:4029397-4029419 ATCCCAGAGGTGAAGGAAGAAGG - Intergenic
900731644 1:4265845-4265867 AAGAAGCTGGTGTAGGAAGAAGG + Intergenic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901948775 1:12724930-12724952 ATGAGGCAGGTTCAGGAAGATGG + Intronic
902360946 1:15942330-15942352 GTGAAGCAAGTGCAGGAAGAAGG - Exonic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
904290005 1:29478690-29478712 ATGGAGCAGGTGAACGCACAGGG + Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904413780 1:30342662-30342684 ATGGCGCAGGTGAAGGCAGAGGG - Intergenic
904531768 1:31174697-31174719 ATGCAGAAGTTGTTGGAAGATGG + Intergenic
904669866 1:32155846-32155868 ATGCAGGAGGCTGAGGAAGAAGG - Intronic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905766707 1:40607537-40607559 ATGCAGCAGGTGGAAGAAGTAGG - Intergenic
905915923 1:41684226-41684248 AAGCAGCAGAGGAAGGAAGTGGG + Intronic
906114965 1:43350335-43350357 AAGCAGCAGATGAAGGATGGAGG - Intronic
906149098 1:43577454-43577476 CAGCTGGAGGTGAAGGAAGAGGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906407254 1:45551850-45551872 TTCCAACAGGTAAAGGAAGAAGG + Intronic
907150181 1:52278530-52278552 ATGCAGCAGTTGGAGGATGGTGG + Exonic
908117709 1:60956454-60956476 TTTCAGCAGATGAAAGAAGAGGG + Intronic
908325869 1:63023107-63023129 TAAGAGCAGGTGAAGGAAGAGGG + Intergenic
909944684 1:81650245-81650267 ACATGGCAGGTGAAGGAAGAAGG + Intronic
910523032 1:88145127-88145149 GTGCAGGAGGAGTAGGAAGAGGG - Intergenic
910835808 1:91508847-91508869 ATGGAGCAGGTGGAAGAAGGAGG - Intronic
911059149 1:93732884-93732906 TTGCTGCAGGTGTAGGAGGAAGG - Intronic
911292971 1:96080476-96080498 AGGCAGCAGGAGAAAGAAGCAGG + Intergenic
911643864 1:100318308-100318330 ATGCAGTAGGTTAAAGAAAAAGG + Intergenic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912724063 1:112043383-112043405 CTGCAGGAGGTGGAGGAAGAGGG + Intergenic
913231727 1:116745519-116745541 ATACAGCAGGGGAAAGATGAAGG + Intergenic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
913715295 1:121527815-121527837 ATGCAGCAGAAGGAGGAAAAAGG - Intergenic
914799648 1:150951184-150951206 AGGGAGGAGGTAAAGGAAGATGG - Intronic
915164473 1:153941021-153941043 CTGCAGCAGCTGCAGGAAGCTGG + Exonic
915998416 1:160589139-160589161 AGGAAGCAAGAGAAGGAAGAAGG - Intergenic
916239322 1:162623436-162623458 ATTCAGGAGGTGAAGGGAGGAGG - Intergenic
916579385 1:166094081-166094103 GTGCAGCAGGGGAAGGAAGCAGG + Intronic
917729644 1:177862010-177862032 ATGGTCCAGGTGAGGGAAGATGG - Intergenic
918138745 1:181702148-181702170 ATGGAGCAGGTTTGGGAAGAGGG - Intronic
918319272 1:183349424-183349446 ATGCTGAAGGCAAAGGAAGAGGG + Intronic
920199469 1:204250638-204250660 CTGCAGCAGGGGCAGGATGAGGG + Intronic
920549938 1:206850765-206850787 AACCAGCAGGTAAATGAAGACGG + Intergenic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922068551 1:222168476-222168498 GGGCAGCAAGAGAAGGAAGAGGG + Intergenic
922357437 1:224789626-224789648 ATGAAGCAACTGGAGGAAGAGGG + Intergenic
922572541 1:226642596-226642618 AACCAGCAGAAGAAGGAAGACGG + Intronic
922660660 1:227427691-227427713 ATGAAGTAGGTGGAAGAAGAAGG - Intergenic
923247574 1:232147458-232147480 AAGGAGGAAGTGAAGGAAGAAGG + Intergenic
923724643 1:236495558-236495580 AGGCAGCAGGTGGAGGAGGGTGG - Intergenic
924202384 1:241673484-241673506 ATGGAGCAGGATAAGGCAGAGGG - Intronic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
1063097918 10:2924307-2924329 ATGCCACAGTTGAAGGAAGAGGG - Intergenic
1063264855 10:4436313-4436335 AGGCAGTAGGTGGAGAAAGAGGG + Intergenic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1063691010 10:8287230-8287252 ATGCAGCAGGAACAGAAAGAAGG - Intergenic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064734285 10:18364657-18364679 AGGCAGGAGATGAAAGAAGAGGG - Intronic
1065620323 10:27574534-27574556 TTGGATCAAGTGAAGGAAGATGG + Intergenic
1067807916 10:49405918-49405940 AGGCAGGAGGAGAAGGAAAAGGG - Intergenic
1068655985 10:59577070-59577092 ATGGAGCAGGTGCAGGAACTGGG + Intergenic
1068660051 10:59614430-59614452 ATGCAGGAGATGCAGGGAGAGGG - Intergenic
1068749590 10:60576812-60576834 TTGCCACAGGTGGAGGAAGAGGG - Intronic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1071736945 10:88311574-88311596 AAGAGGCAGGTGAAGAAAGAAGG - Intronic
1071827292 10:89337763-89337785 ATGCAGGAGGTGAGGTAAGATGG - Intronic
1071876676 10:89850535-89850557 ATGCAGCAGTTCAAGAAAGGAGG + Intergenic
1073063424 10:100745324-100745346 GAGCAGCCGGCGAAGGAAGAGGG - Intronic
1073420919 10:103423047-103423069 GTGCAGGAGGTGTTGGAAGATGG + Exonic
1073659671 10:105461116-105461138 AGGCTGCAGGTGGGGGAAGATGG - Intergenic
1074866706 10:117548104-117548126 AGGCAGAAGCTGGAGGAAGAAGG + Exonic
1076071528 10:127493865-127493887 CAGCAGCAGGTGAAGACAGAGGG - Intergenic
1076376513 10:129991632-129991654 AGCCATGAGGTGAAGGAAGATGG + Intergenic
1077223613 11:1428082-1428104 GGGCAGCAAGTGAAAGAAGATGG + Intronic
1077922256 11:6650397-6650419 ATACAGGAGCTGAAGGAAGGGGG + Intronic
1078143220 11:8706500-8706522 ATGAAGCAGGAGGAGGGAGATGG - Intronic
1078188007 11:9068707-9068729 GTGCAGAAGGTGAAGCAACAAGG - Intronic
1078388190 11:10911622-10911644 ATGCAGCCGGTGGGGGAAGCTGG - Intergenic
1078901653 11:15648257-15648279 ATGAAGCAGGGTAAAGAAGAGGG - Intergenic
1079471738 11:20785052-20785074 TTCCAGCAGGTAAGGGAAGAAGG + Intronic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1081095262 11:38924939-38924961 AGGGAGCAAGAGAAGGAAGAAGG - Intergenic
1081528576 11:43943091-43943113 ATCCAGGAGGTGGAGGAGGAGGG + Exonic
1081571035 11:44291012-44291034 ATGCACCTGGGGAAGGAAGCAGG - Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083525369 11:63360187-63360209 ATGCAGCCAGTGAATGTAGAGGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1084063470 11:66690261-66690283 GTCCAGCAGGTGCAGGACGACGG - Exonic
1084726414 11:70945338-70945360 AGGGAGGAGGTGAAGGCAGAAGG + Intronic
1085228638 11:74945871-74945893 ATGTAGCCGGGCAAGGAAGAGGG - Intronic
1085295110 11:75427081-75427103 ATTGTGCAGGTGAAGGCAGAAGG - Intronic
1085849844 11:80107608-80107630 AGACAGCAGGGGGAGGAAGAAGG - Intergenic
1086193427 11:84108174-84108196 GGGGAGCAGGGGAAGGAAGAGGG + Intronic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087070372 11:94073798-94073820 ATTCTGCAGGTGAAGGCTGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088735039 11:112721663-112721685 CTTCAGCAGATGAAGGCAGAAGG + Intergenic
1088849478 11:113693309-113693331 AGGTAGCAGGTGGAGGAAGCTGG + Intronic
1088881588 11:113977241-113977263 ATGAAACAGGTAAAGAAAGAAGG - Intronic
1089052528 11:115558012-115558034 ACCCAGAAAGTGAAGGAAGAAGG + Intergenic
1090178049 11:124669306-124669328 ATCCAGCAGGTGGCAGAAGAGGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1091111213 11:132970169-132970191 ATGAAGCATGTGAAAGAGGAGGG - Intronic
1091372527 11:135072864-135072886 ATCCAACAGGTGAGGGCAGATGG + Intergenic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092796325 12:12113580-12113602 ATGCAGCTTGTGATGTAAGATGG + Intronic
1092912804 12:13163085-13163107 ATGAAACAGGTGAAGGAATTAGG + Intergenic
1093632511 12:21426082-21426104 ATGCAGCAGGTGAGACGAGATGG - Intergenic
1094088138 12:26616818-26616840 ATTCAGGAGGAGGAGGAAGAGGG - Intronic
1094475435 12:30837190-30837212 ATGGAGCAGGTGATCGAAAAAGG - Intergenic
1094606847 12:31956640-31956662 GTGGAGCAGGTGATGGAAAAAGG + Intergenic
1094762626 12:33551717-33551739 ATGCAAGAGGTGATGCAAGAGGG - Intergenic
1096391452 12:51232314-51232336 AAGCAGAAGGGGAAGGAAGGAGG - Intergenic
1096673585 12:53214558-53214580 AAGAAAGAGGTGAAGGAAGAAGG - Exonic
1097038641 12:56140847-56140869 ATGGAGCAGGTGGAGGAGCAAGG + Intronic
1097105085 12:56617476-56617498 AGGCAGCAGGTGCAGGGGGAAGG + Exonic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1098139030 12:67432688-67432710 ATGTGGCAGGTGAAGGAGAAGGG - Intergenic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1099870033 12:88336011-88336033 ATGATGCAGGTGGAGGTAGAGGG - Intergenic
1100093607 12:91003870-91003892 ATGAAGCAGGTTTAGGCAGAAGG + Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101195115 12:102373673-102373695 ATGCAGAGGGTTAAAGAAGAGGG - Intergenic
1101441026 12:104704360-104704382 AGGCTGCAGGTGAGGGAGGAAGG + Intronic
1101968715 12:109297697-109297719 ATGGACCGGGTGAAGGAAGGGGG - Intronic
1102441382 12:112966404-112966426 CTGCAGCAGGTGGAGGAGGTGGG - Intronic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1103110339 12:118271886-118271908 TTGCAGGAGGTTAAGGAAGAGGG - Intronic
1103582448 12:121925310-121925332 AAGTAGCAGATGGAGGAAGAAGG - Intronic
1104654876 12:130567048-130567070 ATGAAAGAGGTGAAGGAAGTTGG + Intronic
1105284704 13:18994574-18994596 ATGCAGAAGGCCAGGGAAGAAGG + Intergenic
1105750296 13:23416910-23416932 AGGGAGGAGGGGAAGGAAGAGGG + Intronic
1105893693 13:24700254-24700276 AAACAGCATGTGAAGGAACAAGG - Intronic
1107640408 13:42437309-42437331 ATGTTGCAGATGAAGAAAGAAGG + Intergenic
1107995759 13:45859308-45859330 ATACAGGAGGGAAAGGAAGAGGG + Intergenic
1108123244 13:47212579-47212601 CTGTAGCTGGTGTAGGAAGATGG + Intergenic
1108761510 13:53571530-53571552 ATTTAGCAGGTGGAGGAACAGGG - Intergenic
1109564648 13:64096060-64096082 ATGCAGCATGAGAATAAAGAAGG + Intergenic
1109619218 13:64879837-64879859 GAGCAGCAGGGCAAGGAAGAAGG - Intergenic
1110323108 13:74182565-74182587 CTGCAGCTGGTGAAGACAGAAGG - Intergenic
1110767577 13:79298541-79298563 ATGCAGCACGTGAAGAGGGAAGG - Intergenic
1110833160 13:80054530-80054552 AGGCAGGAGCTCAAGGAAGAGGG + Intergenic
1110922038 13:81100799-81100821 ATGAAGCAGTTTAAGAAAGATGG + Intergenic
1110968159 13:81726962-81726984 ATGAACCAAGTGAAGAAAGATGG + Intergenic
1112302100 13:98239894-98239916 TCCCAGCAGGTGAAGGAGGAGGG + Intronic
1113075367 13:106462833-106462855 ATGCAGCAGGATAAGAATGAAGG - Intergenic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113594091 13:111519271-111519293 ATGCAGGAGGAGAAGCCAGAAGG - Intergenic
1113608557 13:111627362-111627384 AGGCAGATGGTGAAGGATGAAGG - Intronic
1113609792 13:111636180-111636202 ATGAAGCAGGTTAGGGAAGATGG - Intronic
1114003903 14:18290267-18290289 ATGCAGGTGGTGAAGACAGAGGG - Intergenic
1114307952 14:21440583-21440605 AGGCAGCAGGGACAGGAAGAGGG + Intronic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114994317 14:28328737-28328759 AAGGAGGAGGTGAAGCAAGATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115298130 14:31853447-31853469 ATGGAGAAGGTGGAGTAAGAAGG - Intronic
1115557395 14:34554306-34554328 TTGAAGCAGGTGAAGGGAGTTGG + Intergenic
1115568998 14:34649491-34649513 ATGAAGCTGGTGAAGGGAGCTGG - Intergenic
1115914397 14:38295094-38295116 ATTCAGCAGGAGAACAAAGAAGG + Intergenic
1116659576 14:47692045-47692067 ATGCAGCAAGGGAGGGAAGAAGG - Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1116774942 14:49168142-49168164 ATGCAGTCGGAGAAGTAAGAAGG + Intergenic
1117982383 14:61354668-61354690 ATTCGTCAGGTGAAGGGAGAGGG - Intronic
1118004488 14:61553300-61553322 ATGCAGCAGCGTCAGGAAGAAGG + Intronic
1118536561 14:66772991-66773013 ATGAAGGAAGTAAAGGAAGAAGG - Intronic
1118747562 14:68785235-68785257 ATCCAGGGCGTGAAGGAAGAAGG - Intergenic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119473072 14:74911255-74911277 ATGCTCCAGGTGCAGGAAGATGG + Exonic
1119623113 14:76147944-76147966 ATGCAGGAGGTAGTGGAAGATGG + Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120712022 14:87802806-87802828 ATGAAGCATGTGAAGGCAAAGGG - Intergenic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121526677 14:94624174-94624196 CTGCTGCAGCTGAAGGCAGAAGG - Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1202828868 14_GL000009v2_random:4526-4548 ATAAAGCAGGCGGAGGAAGATGG + Intergenic
1124785965 15:32680744-32680766 AAGAAGCTGGTTAAGGAAGAAGG + Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125609422 15:40960599-40960621 AAGCAGAAGGTGTGGGAAGAAGG + Intergenic
1125746579 15:42001163-42001185 ATCCAGGAGGCGGAGGAAGAGGG - Exonic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128336839 15:66792143-66792165 ATGATGCTTGTGAAGGAAGAAGG + Intergenic
1128741375 15:70086107-70086129 AAGCAGCAGGTGATGCCAGATGG - Intronic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128955390 15:71936991-71937013 AGGAAGCAAGTGAGGGAAGAAGG + Intronic
1129007908 15:72389841-72389863 ATGAAGCAGATGCAGGAAAAGGG - Intergenic
1129878273 15:78991192-78991214 TAGCATCAGATGAAGGAAGAGGG + Intronic
1129944280 15:79525494-79525516 AGGAAGGAGATGAAGGAAGAAGG + Intergenic
1130379721 15:83360986-83361008 GGGCAGCAGGAGAGGGAAGAAGG - Intergenic
1130939639 15:88497001-88497023 AGTCAGCAGGTGGGGGAAGATGG - Intergenic
1131086682 15:89581526-89581548 ATTCAGTTGGTGAAGAAAGAAGG + Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131582700 15:93660757-93660779 CTGCAACATGTGCAGGAAGATGG + Intergenic
1131746100 15:95449374-95449396 CTGCTCCAGGTGAATGAAGAGGG - Intergenic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1132231284 15:100186130-100186152 ATGAAGTATGTGAAGGAAGTAGG + Intronic
1132448530 15:101951733-101951755 AGGCAGCAGGGGAAGGATGAAGG + Intergenic
1133867722 16:9659594-9659616 ATGCAGCTTGTGAAGGAGCAGGG + Intergenic
1133868353 16:9665009-9665031 ATGAACTAGGTGAAGAAAGAAGG - Intergenic
1133917127 16:10119215-10119237 ATTCAGTAGGAGGAGGAAGATGG + Intronic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134222005 16:12362394-12362416 CTGCAGCAGGTGGAGGAGGCTGG - Intronic
1135694936 16:24577398-24577420 ATGAAGCAGGCAAAGGAGGAAGG - Intergenic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136994624 16:35181358-35181380 AGGCACCAGGTGAATGAGGATGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139485269 16:67252671-67252693 AGGCAGCAGGAAGAGGAAGAAGG - Exonic
1140898293 16:79345147-79345169 ATTCAGCAGGTTAGGGAAAAAGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143051916 17:4132976-4132998 GTGGAGCAGGTGGGGGAAGAAGG + Intronic
1143249076 17:5509327-5509349 AGGAAGCAGGGGAAGGAAGAAGG - Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143250610 17:5520667-5520689 ATGCAGGATGTGAAGGATGATGG - Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143735034 17:8905626-8905648 ATGCTGGAGGTGAGGGAGGAGGG - Intronic
1144233317 17:13231115-13231137 ATGAAGAGGGTGCAGGAAGAAGG - Intergenic
1144721044 17:17470178-17470200 ATGCAGCTGGTGGTGGGAGAAGG - Intergenic
1145103879 17:20098740-20098762 AGGCAGCAGGAGGAGGAGGATGG - Intronic
1145799270 17:27672743-27672765 ATGAAGCATGAGAAGGTAGAGGG - Intergenic
1146164071 17:30574633-30574655 GGGCAGCAGGGGAAGGAAGGTGG - Intergenic
1146455873 17:33009330-33009352 AGGCAGCAGGGGAAGAAAGAAGG - Intergenic
1146611114 17:34305747-34305769 AGGCAGCAAGTGAAGGAATCTGG + Intergenic
1147425463 17:40344042-40344064 AGGCAGCAGGTCCAGGAAGGTGG - Intronic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1150201272 17:63360360-63360382 ATGAAGCATGGGAAGGAAAAAGG + Intronic
1150293046 17:63992906-63992928 ATGTAGGAGGGGAAGGAAGGAGG + Intergenic
1151345264 17:73497573-73497595 ATGCAGGAGAGGGAGGAAGATGG - Intronic
1152463936 17:80455267-80455289 CTGCAGCAGGGGAAAGAAGGAGG + Intergenic
1152608562 17:81304843-81304865 ATGCCGCAGGGGACGGCAGAGGG - Intergenic
1152660137 17:81538242-81538264 TTGGAGCAGGTGGAGGAAGCTGG + Intergenic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153733786 18:8043662-8043684 AGGAAGCAGGAGAGGGAAGAGGG - Intronic
1153835115 18:8956786-8956808 AGGCAGTAGGTGAAAGAGGAAGG - Intergenic
1154012324 18:10586080-10586102 ATACAACAGGGTAAGGAAGATGG - Intergenic
1154110875 18:11567484-11567506 CTGGAGGAGGTGGAGGAAGAGGG + Intergenic
1155434549 18:25798070-25798092 ATGCAGCAAGGGGAGGACGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156229383 18:35139101-35139123 ATGCTGCAGGAGAAGAGAGAAGG + Intronic
1156625155 18:38899867-38899889 AGGGAGCAGGGGTAGGAAGAGGG - Intergenic
1157212307 18:45754129-45754151 AGGCAGGAGGTGGAGGAAGGTGG + Intergenic
1157378556 18:47189831-47189853 ATGCAGACTGTGAAGGCAGAGGG + Intergenic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1158195721 18:54883053-54883075 AGACACCAGGTGAAGGAGGAAGG + Intronic
1158942855 18:62421741-62421763 CTACAGTAGGTGAAGAAAGAAGG - Intergenic
1159540109 18:69764177-69764199 AGGCAGCAGGTGTAGAGAGACGG - Intronic
1160636731 19:80820-80842 AGGCAGCAGGGGAGGGATGAAGG - Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1163160277 19:15460135-15460157 ATGCAGGAGGTGGAGGAGGAGGG + Intronic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165908988 19:39212372-39212394 AGGAAGCCGGTGAAGGAAGCTGG + Intergenic
1167388696 19:49180155-49180177 ATGGAGCAAGTGGAGGCAGAAGG + Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167785492 19:51632457-51632479 GTGCAGCAGGTGAGGGAGGCTGG - Intronic
1168606380 19:57763377-57763399 ATGCACCAGGTGAATGAACCTGG + Intergenic
1202643827 1_KI270706v1_random:123274-123296 ATAAAGCAGGCGGAGGAAGATGG - Intergenic
925253323 2:2461122-2461144 ATGAGGCTGGTGAAGGAAGGAGG - Intergenic
926083041 2:10004205-10004227 ATACAGCAGGTGAAGGAGGTTGG - Intergenic
926226073 2:10967749-10967771 ACACAGCAGATGAAGGAAAATGG - Intergenic
926234091 2:11026414-11026436 CTGCAGCAGGGGCAGGCAGATGG - Intergenic
926795670 2:16617131-16617153 ATGCTGCAAATCAAGGAAGAAGG - Intronic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
928402279 2:30987731-30987753 AGGCAGCAGGTGGGGGAGGAGGG - Intronic
928443257 2:31311310-31311332 ATGCAGGTGGTCAAGGAAGTGGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929977996 2:46653678-46653700 ATAGAGCAGGTGAAGGGAGTGGG - Intergenic
931974916 2:67632918-67632940 ATGAAGCAGGTGAAGGTCCAGGG + Intergenic
932733946 2:74241135-74241157 AGGCAGAAAGAGAAGGAAGAAGG + Intronic
933309819 2:80646604-80646626 ATGCAGGCAGTGAAGCAAGAAGG + Intronic
933480560 2:82851775-82851797 ATGCAGCAGCTGAGAGAAAAAGG + Intergenic
936564747 2:113574221-113574243 AGGCAGCAGGGGAGGGATGAAGG + Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
938532621 2:132204856-132204878 ATGCAGGTGGTGAAGACAGAGGG + Intronic
938752536 2:134347150-134347172 ATGCAGGATGTGATTGAAGAAGG + Intronic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939240454 2:139552200-139552222 ATGGAGGAGGTCAAGGAAGGAGG - Intergenic
939444437 2:142290516-142290538 ATGCAGGAGGGATAGGAAGAGGG + Intergenic
939897582 2:147810595-147810617 ATGCAGCAGGAGAAGGCTAATGG + Intergenic
941821654 2:169849872-169849894 ATGCAGGAGAGGAAGGAAGCAGG + Intronic
941995997 2:171602528-171602550 AGGAAGTAGGAGAAGGAAGAGGG - Intergenic
942234028 2:173887092-173887114 ACGTAGCAGGTGAAAGTAGAGGG + Intergenic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
943304602 2:186244396-186244418 AGGAAGCAGGGGAAGGATGATGG + Intergenic
943793682 2:191965238-191965260 AAGAAGCAGGGGAAGGAAGTGGG - Intronic
944113396 2:196160200-196160222 ATGCAGAAGGGGAATGCAGAAGG - Intronic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944911826 2:204317974-204317996 CTAGAGCAGGTGAAGGATGAAGG - Intergenic
945511317 2:210706501-210706523 CAGCAGCAGTTGAATGAAGAAGG + Intergenic
946353354 2:219169676-219169698 ATGCTGCAGGTGGAGGAATGGGG + Exonic
946429846 2:219619702-219619724 ATGCAGTAGATGAGGGAACAAGG - Intergenic
947087795 2:226475154-226475176 TGGAAGCAGGAGAAGGAAGAAGG - Intergenic
947192541 2:227522703-227522725 ATGAAGTAGGTGAGGAAAGAAGG - Intronic
947831655 2:233145835-233145857 ATGCAGCAGGTGTAGGAGGGAGG + Intronic
947855472 2:233320846-233320868 GTGCTGCGGGTGAAGGAAGCAGG - Intronic
947914015 2:233820185-233820207 CTGCAGGAGGTACAGGAAGAGGG - Intronic
948019037 2:234715200-234715222 ATACAGCAGATGAAGGCTGATGG + Intergenic
948024391 2:234765285-234765307 GTGCAGCAGGTGGAGGAGGCTGG - Intergenic
948205703 2:236161797-236161819 GTCCAGCAGGGGAAAGAAGAGGG + Intergenic
1169574064 20:6938907-6938929 AGGGAGCTAGTGAAGGAAGAAGG - Intergenic
1170823043 20:19770634-19770656 AGGCAGCAGGAGGTGGAAGAGGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1173185034 20:40834024-40834046 ATGGAGGAGGTGAAGAGAGAGGG + Intergenic
1173791620 20:45831644-45831666 AAGAAGCAGGAGGAGGAAGAAGG + Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1175371794 20:58497212-58497234 ATGCAGCGGGTGGAGGCTGAGGG + Intronic
1175588751 20:60169943-60169965 ATGCAGCAGGTGAAGAAAGTTGG + Intergenic
1175732823 20:61365609-61365631 ATGCAGCTGGCGAGGGAAGCTGG + Intronic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176608050 21:8849354-8849376 ATAAAGCAGGCGGAGGAAGATGG + Intergenic
1177299257 21:19219574-19219596 AAGCAGAAGGGGAAGGGAGAAGG + Intergenic
1177593093 21:23198975-23198997 AAGCAGCAAAGGAAGGAAGAAGG - Intergenic
1178666213 21:34549231-34549253 AGGCACCAGGTGAAAGAAGAGGG + Intronic
1179112944 21:38463053-38463075 ATGCACCAGGTGTACCAAGATGG - Intronic
1179197010 21:39173689-39173711 AGGCAGCAGGTGCAGGAGGTTGG - Intergenic
1179521131 21:41945767-41945789 AGGCGGCAGGAGAGGGAAGAAGG - Intronic
1180358142 22:11859159-11859181 ATAAAGCAGGCGGAGGAAGATGG + Intergenic
1180380124 22:12133171-12133193 ATAAAGCAGGCGGAGGAAGATGG - Intergenic
1180428417 22:15221070-15221092 ATGCAGGTGGTGAAGACAGAGGG - Intergenic
1180511026 22:16089419-16089441 ATGCAGGTGGTGAAGACAGAGGG - Intergenic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1181819198 22:25462563-25462585 ACGCAGAAGGGGGAGGAAGAGGG - Intergenic
1182084906 22:27554857-27554879 AGGCACCAAGAGAAGGAAGAGGG + Intergenic
1182850209 22:33467375-33467397 ATGCAGCAGTTTAAGGAAAGAGG - Intronic
1183443674 22:37838577-37838599 GTGCAGCAGCTGCTGGAAGATGG - Exonic
1183670355 22:39269203-39269225 ATGAAGCAGGTAAAGGCAGGAGG - Intergenic
1184174114 22:42776860-42776882 ATACAGCAGGTGAAGGCACCTGG + Intergenic
1185160938 22:49229452-49229474 AGGCAGCAGGTGCATGACGAGGG - Intergenic
949367899 3:3302786-3302808 AGGCAGCAGGAGAGAGAAGAAGG - Intergenic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
950145821 3:10648965-10648987 ATGCAACAGGTGAATCAACATGG - Intronic
950358223 3:12429572-12429594 AAGAAGCAGGTGGAGGAAGGAGG + Intronic
951716328 3:25651478-25651500 AGGCAGCAAGGGAAGAAAGATGG + Intronic
951829949 3:26915326-26915348 ATGCAGCAGGTGCAGCCTGATGG - Intergenic
953091016 3:39726191-39726213 ATGGAGCAGGTAAAGGCAGCTGG - Intergenic
953236225 3:41110011-41110033 AGGCAGCAGGGCAAGGAAAAAGG + Intergenic
953497057 3:43396775-43396797 ATTCAGGAGGTGAAGGCAGGAGG - Intronic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953972852 3:47360475-47360497 GTGGAGCAGGTGATGGAAAAAGG + Intergenic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
954211491 3:49100024-49100046 ATGAAGCTGGTGATGGAGGATGG - Exonic
954997659 3:54896232-54896254 AGGAGGCAGGTGAGGGAAGAAGG + Intronic
955364341 3:58298593-58298615 CTGCAGCAGGGGGTGGAAGAAGG + Intergenic
955444478 3:58994866-58994888 TTCCGGCAGGTGAGGGAAGAAGG + Intronic
955744094 3:62122860-62122882 ATGCAGCAGTGTAAGGAAAATGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
957973288 3:87410269-87410291 ATGCAGCAGCCTCAGGAAGATGG + Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
960113490 3:113869107-113869129 ACTTAACAGGTGAAGGAAGAAGG + Intronic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
960417304 3:117400117-117400139 ATGCAGGAGGTCAGGGCAGAGGG + Intergenic
960744562 3:120872855-120872877 AGGCAGTAGGAGAAAGAAGAAGG + Intergenic
960993184 3:123324915-123324937 ATGCAGGAGGTGCTGGAAGAGGG + Intronic
961263183 3:125618933-125618955 ATGAAGCAGGTGAAGAAGGTGGG + Intergenic
961356533 3:126343276-126343298 ATGCTGGAGGAGAAGGAAGTAGG - Exonic
962505851 3:136045710-136045732 ATGCAGTAGGTCAAGGGTGAGGG - Intronic
963793099 3:149604496-149604518 ATGCAGGAAGTGAAGGAAGGAGG + Intronic
964149137 3:153503000-153503022 ATGAAGCAGGTTAAGGGAGAAGG + Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965551268 3:169967074-169967096 GAGCAGCAGGGGAAGGAAGGAGG + Intronic
967765190 3:193271579-193271601 TTGCAGCAGGTGGAGAAAGGGGG + Intronic
968040653 3:195586490-195586512 TTGCAGCAGGTGAAAGAATGAGG - Intergenic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969278323 4:6152047-6152069 AGGAAGCAGGCGAAGGAGGAAGG + Intronic
970316097 4:14829668-14829690 ATGGCTCAGGTGAAGGCAGAGGG + Intergenic
970386052 4:15557974-15557996 ATGAAGGAGGTAAAGGAACAGGG + Intronic
970508415 4:16756021-16756043 ATGGAGCACGTGGAGGAAGAGGG + Intronic
971473939 4:27055190-27055212 ATTTAGCAGGTGAAGGCAGATGG + Intergenic
972125437 4:35759190-35759212 AGGGAGGAGGTGAAGCAAGATGG - Intergenic
972239611 4:37175862-37175884 ATGTAGAAGGTGAAGAAACATGG - Intergenic
972987754 4:44785458-44785480 ATGCAGCAGTTTAAAGAGGAGGG - Intergenic
974096519 4:57370376-57370398 GTTCAGGACGTGAAGGAAGAGGG - Intergenic
974252373 4:59403260-59403282 TTGAAGCATGTGTAGGAAGAGGG - Intergenic
974900133 4:67986687-67986709 AAGCAGCACTAGAAGGAAGAAGG + Intergenic
974940805 4:68465461-68465483 AAGCAGCATGTGAAGTAAGTGGG + Intronic
975495683 4:75033867-75033889 ATGCTGCCTGTGAAGGAGGAAGG - Exonic
976588853 4:86828962-86828984 ATTCAGGATGTGAAGGAGGATGG + Intronic
976605357 4:86977557-86977579 ATGCAGGGGGTGAGGGAAAAAGG - Intronic
976692709 4:87885856-87885878 GTGTAGCAGGTGGAGGAAGGAGG + Intergenic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
978272223 4:106904691-106904713 ATGCAGCATGTGAGAGAAAAGGG - Intergenic
978479189 4:109169415-109169437 CTACAGCAAGTGAAGGAAAAGGG - Intronic
978644683 4:110915857-110915879 ATGGAGCAGGGTAAGGGAGATGG + Intergenic
979100385 4:116604856-116604878 ATGGAGGAGGTGGAGCAAGATGG - Intergenic
979552966 4:122011741-122011763 AGGCAGCAGATTAAGTAAGAAGG - Intergenic
981171864 4:141635034-141635056 CTGCAGCCGGTGAAGGAAGCAGG - Intergenic
982321839 4:154084968-154084990 ATTCAGCAGGAGCAGGATGAAGG + Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982786096 4:159538518-159538540 CTGAAGCAAGTCAAGGAAGAAGG + Intergenic
983902225 4:173147688-173147710 ATACAGTTGGTAAAGGAAGATGG - Intergenic
984731070 4:183068808-183068830 ATGCAGGAAATGAAGGAAAATGG + Intergenic
985188402 4:187344252-187344274 ATGCAGCAGATATTGGAAGATGG - Intergenic
985695215 5:1336228-1336250 ATGCAGCAGGTGCAGGAAGTCGG - Intronic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986866600 5:11996486-11996508 GTGCAGGAGGTGACGGAAGGAGG - Intergenic
986936555 5:12895363-12895385 ATAATGCAGGTGAAGGTAGAGGG + Intergenic
987725941 5:21699671-21699693 ATGGCACATGTGAAGGAAGAAGG - Intergenic
988597193 5:32606061-32606083 GTGCAGCATCTGAAGGAAGGTGG + Intergenic
988728911 5:33950687-33950709 ATGGCCCAGGTGAAGGAAGTGGG - Intronic
988851062 5:35181344-35181366 ATGTTGCAGGTGAAGTAAAAGGG + Intronic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
989708415 5:44366452-44366474 AAGAAGGAGGTGAAGAAAGAAGG + Intronic
989756214 5:44958755-44958777 AGGAAGGAGGAGAAGGAAGAAGG - Intergenic
990518951 5:56558921-56558943 AAGCCACAGGTGAAGGAATAAGG - Intronic
990957639 5:61359512-61359534 GTACACCAGGTGAATGAAGATGG + Intronic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
991537415 5:67686182-67686204 ATGGAGGAAGTGAAGCAAGATGG - Intergenic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993698861 5:91094669-91094691 ATGCAGCATATGAAGGAAAATGG + Intronic
994122316 5:96129478-96129500 CTGCACCAGGTAAATGAAGAAGG + Intergenic
994297035 5:98102855-98102877 CTGCAGCAGATGAAGTCAGATGG - Intergenic
996231700 5:121071412-121071434 AGGCAGGAGGTGAAGGCAGGAGG + Intergenic
997943589 5:138179837-138179859 AAGCAGCAGGTAAAGGAACTGGG + Exonic
998014185 5:138719148-138719170 AAGAACCAAGTGAAGGAAGAAGG - Intronic
1000345101 5:160307787-160307809 ATGCAGCAGGGACAGGAAGAAGG + Intronic
1000603888 5:163307521-163307543 AGTCAGAAGGTTAAGGAAGAAGG - Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001321172 5:170683005-170683027 TTAAAGCAGGGGAAGGAAGATGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001971249 5:175956614-175956636 CAGCAGCGGGTGAAGGAGGAGGG - Intronic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002246193 5:177887163-177887185 CAGCAGCGGGTGAAGGAGGAGGG + Intergenic
1002523006 5:179801615-179801637 GTGTGGCAGGTGATGGAAGACGG + Exonic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003477910 6:6501811-6501833 CTGCAGCAGCTGACAGAAGATGG + Intergenic
1003593787 6:7456756-7456778 ATGCGCCAGGTGAAGGCAGCTGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004400868 6:15287662-15287684 AGGCAGCAACTGCAGGAAGAAGG - Intronic
1005289962 6:24370099-24370121 ATGCATCAAGTGAAAGAAAAAGG + Intergenic
1005416626 6:25606634-25606656 AAGCAGCAGTTTAAGGAGGAAGG + Intronic
1008419718 6:51284033-51284055 ATGAAGGAGGTGGGGGAAGAGGG + Intergenic
1008428666 6:51389036-51389058 ATGGAGCGGGTGAAGGTAAAAGG - Intergenic
1008875142 6:56317816-56317838 ATCAAGTAGGTGAAGGAAGGTGG - Intronic
1009313677 6:62190089-62190111 ATCCAGCAAATGAAGTAAGAAGG + Intronic
1010042076 6:71396775-71396797 GTGCAGAAGGGGTAGGAAGAGGG - Intergenic
1011556703 6:88576831-88576853 GAGGAGCAGGTGAATGAAGAAGG + Intergenic
1012345020 6:98174482-98174504 ATGTAGCAGGGGAAGGATGCAGG + Intergenic
1012815507 6:104018067-104018089 ATGCAGCAAGGGAGGGCAGATGG + Intergenic
1013038666 6:106411932-106411954 ACAAAGCAGGTGAAAGAAGAGGG - Intergenic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1014166150 6:118227297-118227319 CTGCAACAGGTGAAGCAAGATGG + Intronic
1014207029 6:118667078-118667100 AGGCACCAAGTGAAGAAAGAGGG + Intronic
1014320428 6:119922152-119922174 ATTCAAAATGTGAAGGAAGAAGG - Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014639962 6:123897374-123897396 AACCAGCAGGTGAAGGAAACAGG - Intronic
1014761134 6:125357953-125357975 AGGAAGCAGGTGAGAGAAGATGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015866686 6:137734175-137734197 AGGTAGCAGATGTAGGAAGAAGG - Intergenic
1016028004 6:139308407-139308429 ATGCAGTAGGTAGTGGAAGAGGG + Intergenic
1016633153 6:146255780-146255802 ATGTAGCGTGTGAAGAAAGATGG - Intronic
1017230377 6:152067324-152067346 AGGCAGCAGGTGTCGAAAGACGG + Intronic
1017647926 6:156556159-156556181 ATGCAGGGGATGAAGGGAGAGGG - Intergenic
1018238691 6:161751871-161751893 ACACAGCAGGTGAAGGAGAAGGG + Intronic
1018333513 6:162759945-162759967 AAGGAGCAAGTGAAGCAAGAGGG + Intronic
1018854899 6:167668233-167668255 AGGCAGCAGATGAGGGCAGAAGG - Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019170927 6:170132773-170132795 AGGCACGAGGTGAAGAAAGACGG + Intergenic
1019960044 7:4451475-4451497 ATGCAGTAGGTGAAGTATGAAGG + Intergenic
1020081375 7:5287768-5287790 AGAGAGCAGGTGAGGGAAGAAGG - Intronic
1020951568 7:14685346-14685368 ATGCAGAACGTGAAGGATGATGG - Exonic
1022972550 7:35530898-35530920 AGGAAGCAGGTGGAGGAAAAAGG - Intergenic
1023154283 7:37232517-37232539 ATGGACCTGGTGCAGGAAGATGG - Intronic
1023158750 7:37277476-37277498 ATGCAGGAAGAAAAGGAAGACGG + Intronic
1023318199 7:38963623-38963645 GTGAAGCAGGTGAAGGATGTAGG + Intergenic
1023832538 7:44048247-44048269 AAGCAGCAGGTAACAGAAGATGG - Intronic
1023940196 7:44764498-44764520 ATGCAGCGTGTGATGGAGGAGGG + Intronic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024385749 7:48749167-48749189 AGGCTGAAGGTGAAGGAAGTTGG - Intergenic
1024422286 7:49182681-49182703 AGCCATCAGGTGAAGGAGGATGG + Intergenic
1024636921 7:51298727-51298749 ATGCAGCATGTGAAGTGACAGGG - Intronic
1025197536 7:56944380-56944402 AGAGAGCAGGTGAGGGAAGAAGG + Intergenic
1025674411 7:63632559-63632581 AGAGAGCAGGTGAGGGAAGAAGG - Intergenic
1026905077 7:74058172-74058194 AAGCAGGAGGAGGAGGAAGAGGG - Intronic
1027233623 7:76285652-76285674 AAGCAGCTGGAGGAGGAAGAGGG - Exonic
1027520060 7:79195591-79195613 AGGCAGCAGGAGATGGGAGAGGG - Intronic
1027683113 7:81245213-81245235 AGGAAGGAGGAGAAGGAAGAAGG + Intergenic
1027691948 7:81358773-81358795 ATGCTGCAGGGGACGGTAGAGGG - Intergenic
1027831915 7:83187653-83187675 ATGAAGCTGGAGAAGGAATAAGG + Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1028074641 7:86496865-86496887 AGGCAGAAGGTGAACTAAGAGGG + Intergenic
1028228197 7:88274436-88274458 ATGAGGGAGGTGAAGGATGAAGG - Intergenic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029797584 7:102911150-102911172 TTGGAGGAGGTGAAGCAAGATGG - Intronic
1030015282 7:105213204-105213226 ATAGAGCAGGTGGATGAAGAAGG + Intronic
1030207481 7:106964989-106965011 ATTAAGTAGGGGAAGGAAGAAGG - Intergenic
1030717508 7:112827360-112827382 ATTCAAAAGATGAAGGAAGAGGG - Intronic
1030773370 7:113502471-113502493 TTGCAGAAGGTAAGGGAAGAAGG + Intergenic
1030881519 7:114886211-114886233 ATGATGCAGGGGAGGGAAGAAGG + Intergenic
1031541151 7:122996039-122996061 ATGCAGGACGTGAATGAACAGGG - Intergenic
1031697714 7:124879178-124879200 ATCCAGGAGGTGAACAAAGATGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031873511 7:127112359-127112381 ATGCAGGTGGTGAAAGAGGAAGG - Intronic
1032695476 7:134332352-134332374 ATGCAAGAAGTGGAGGAAGACGG - Intergenic
1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG + Intronic
1033506407 7:142006611-142006633 TTGTAGCAGGTGATGGAACATGG - Intronic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034998781 7:155594993-155595015 AGGCAGGAGGGGAAGGAGGAAGG + Intergenic
1035399455 7:158555360-158555382 ATGCTGCTTGTGAAGGGAGAAGG - Intronic
1035617028 8:1009706-1009728 ACGCAGCAGGTGAAAGGAAAAGG - Intergenic
1035732741 8:1864447-1864469 ATTCAGCAGGTGTGGGAAGACGG - Intronic
1035850990 8:2919167-2919189 ATGCTGCAGGAGAAGGAGAAAGG - Intergenic
1036059280 8:5296779-5296801 ATTCTGCAGGTGAATGAAAAAGG + Intergenic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1036902859 8:12684638-12684660 ATCCAACAGGTTAAGGAAAAAGG + Intergenic
1037386041 8:18343051-18343073 TGGCAGCATGTGATGGAAGAAGG - Intergenic
1037570371 8:20152815-20152837 ATGAAGTAGGTGAGGGGAGATGG + Intronic
1037731726 8:21531250-21531272 ATGCAGCAGTTGAAAGCAGTAGG + Intergenic
1038003135 8:23407325-23407347 ATGAAGCATGTGAAGGAAAAGGG - Intronic
1038186776 8:25282388-25282410 ATACAGCAGGTGAAAGGAGATGG - Intronic
1038795236 8:30703776-30703798 GGGGAGCAGGGGAAGGAAGAAGG + Intronic
1039629633 8:39096033-39096055 ATGCAGCAAGGGAAGAAGGAAGG - Intronic
1040463998 8:47677881-47677903 ATGCAAAAGGGGAAGTAAGAGGG + Intronic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1042721281 8:71829330-71829352 ATTCTGCAGGTTAAGGCAGAGGG + Intronic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043147003 8:76672082-76672104 ATTAGGCAGATGAAGGAAGATGG - Intergenic
1043331245 8:79120980-79121002 ATACAGCAGGGAAAGGATGAAGG + Intergenic
1043737058 8:83761643-83761665 ATGCAGAAGCTTAAGGAATATGG + Intergenic
1043918587 8:85953741-85953763 ATGCAGCAGATGAAAGAATAAGG - Intergenic
1044072195 8:87776190-87776212 TTACAGAAGGTAAAGGAAGAGGG - Intergenic
1044388511 8:91620215-91620237 ATACAGCAGGTAAAGAAAGATGG - Intergenic
1045354786 8:101375754-101375776 CTGCAGCACGTGAAGCAGGAAGG + Intergenic
1046146629 8:110169980-110170002 ATGCAGTAGATACAGGAAGAAGG - Intergenic
1047655738 8:126974976-126974998 CTGCAGCAGGTCAATGAGGAAGG - Intergenic
1047862468 8:128983561-128983583 ATGCAGCAGGTAATCTAAGAAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1049684842 8:143935154-143935176 AGGCAGCAGGGGAAGGGACAGGG + Intronic
1049887674 9:38993-39015 AGGCAGCAGGGGAGGGATGAAGG - Intergenic
1050692491 9:8243498-8243520 AAGGAGCAGGTACAGGAAGATGG + Intergenic
1050838741 9:10118904-10118926 ATAAAGGAGATGAAGGAAGAGGG + Intronic
1050965270 9:11793202-11793224 ATGCAGCAGTTTTAGGGAGAAGG + Intergenic
1053093444 9:35301910-35301932 ATTCGCCAGGTGGAGGAAGATGG + Intronic
1053140907 9:35682174-35682196 AAGCAGCAGGTGAGGGAGAAGGG + Intronic
1053685761 9:40520858-40520880 ATGCAGGTGGTGAAGACAGAGGG + Intergenic
1053935709 9:43149151-43149173 ATGCAGGTGGTGAAGACAGAGGG + Intergenic
1054277974 9:63104113-63104135 ATGCAGGTGGTGAAGACAGAGGG - Intergenic
1054298841 9:63356297-63356319 ATGCAGGTGGTGAAGACAGAGGG + Intergenic
1054396864 9:64660819-64660841 ATGCAGGTGGTGAAGACAGAGGG + Intergenic
1054431506 9:65166023-65166045 ATGCAGGTGGTGAAGACAGAGGG + Intergenic
1054498873 9:65855502-65855524 ATGCAGGTGGTGAAGACAGAGGG - Intergenic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1055932218 9:81571280-81571302 AAGCAGAAGGGGAAGGAAAAGGG + Intergenic
1056256915 9:84808902-84808924 AGACACCAGGTGGAGGAAGATGG + Intronic
1056275895 9:84993857-84993879 ATTCACCAGGTGAAGGGAGGAGG - Intronic
1056629773 9:88283679-88283701 CTCCAGCAGGTGAAGGCTGAGGG - Intergenic
1056855965 9:90129910-90129932 AGGCAGCAGGTCAAGAAAGGAGG + Intergenic
1059170173 9:112117231-112117253 CTGGAGCAGGTCAAGGCAGAGGG + Intronic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1060213032 9:121722067-121722089 AGGCAGGAGCTCAAGGAAGAAGG + Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1061078462 9:128355758-128355780 AGGCAGGAGGCGCAGGAAGATGG - Exonic
1061973632 9:134057603-134057625 ATTCCGGAGGTGAAGGAGGAAGG - Intronic
1062083874 9:134638598-134638620 ATGGAGGAGGTGGAGGAACAAGG - Intergenic
1062231860 9:135486338-135486360 ATGCAGGAGGTGGTGAAAGACGG + Exonic
1062460094 9:136659400-136659422 CTGCAGGAGGTGCAGGAGGAGGG - Exonic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1062703700 9:137922455-137922477 TTGCTGGAGGTCAAGGAAGATGG + Intronic
1203703403 Un_KI270742v1:14261-14283 ATAAAGCAGGCGGAGGAAGATGG + Intergenic
1186129960 X:6455827-6455849 ATACAGCAGGTAAAGGAACATGG - Intergenic
1187467992 X:19543216-19543238 ATGCAGAGGGTGGAGGAGGAAGG + Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188089190 X:25941301-25941323 ATGCAGAAGGTGGATGGAGAAGG + Intergenic
1189364740 X:40379949-40379971 AAGCTGCAGGAGGAGGAAGAGGG - Intergenic
1190243803 X:48677238-48677260 TTGCAGCAGGGGAAAGAAAAGGG + Intronic
1190283088 X:48944213-48944235 ATCAAGCAGATGAAGGAGGATGG - Exonic
1190730145 X:53220476-53220498 ATTCAGCTGGCCAAGGAAGAAGG + Intronic
1191732562 X:64353006-64353028 ATGCAGGGGGAGAAGGAAGGAGG - Intronic
1192314231 X:70039561-70039583 AGGCAGCAACAGAAGGAAGATGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1195663879 X:107410503-107410525 ACAAAGCAGGTGGAGGAAGAGGG - Intergenic
1195691263 X:107627850-107627872 TTGAAACAAGTGAAGGAAGATGG - Intergenic
1195705422 X:107734686-107734708 CTGAAGCAAGTGAGGGAAGAGGG + Intronic
1195821294 X:108947507-108947529 ATGCTGCAGCTGCTGGAAGATGG + Intergenic
1195923175 X:110002639-110002661 CTGCTGCAGGGGGAGGAAGACGG + Intronic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1197460373 X:126734158-126734180 ATTCAGCATGTGAAGTAAGAGGG + Intergenic
1198171822 X:134114362-134114384 AAGGAGCTGGTGAAGGAAGCAGG + Intergenic
1198269278 X:135039294-135039316 ATGCAACAGGGAGAGGAAGAAGG - Intergenic
1200150670 X:153949928-153949950 GTGCAGCAGGTGAGGGATGGAGG - Intronic
1200273596 X:154711489-154711511 AAGAAACAGGTGGAGGAAGATGG + Intronic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200754864 Y:6981589-6981611 ATCCTGCAGATAAAGGAAGAAGG + Intronic