ID: 912412624

View in Genome Browser
Species Human (GRCh38)
Location 1:109489017-109489039
Sequence CAGCCACCGCTGCTACAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912412624 Original CRISPR CAGCCACCGCTGCTACAACC TGG (reversed) Exonic
900464153 1:2815908-2815930 CAGCCACCGCTGCCAAAGCCTGG - Intergenic
904699719 1:32351320-32351342 CTGCCACCGGTGCTTCCACCTGG + Intergenic
906880328 1:49582543-49582565 CAGCCACTGGTGCTGGAACCAGG - Intronic
911813347 1:102312071-102312093 CAGCCACTGCTGCTGATACCAGG - Intergenic
912412624 1:109489017-109489039 CAGCCACCGCTGCTACAACCTGG - Exonic
912459175 1:109819710-109819732 CAGCCGCTGCTGCTGCTACCAGG - Intergenic
912681225 1:111730171-111730193 CAGCTACAGCTGCTAAGACCTGG + Intronic
912900051 1:113638512-113638534 CAGCTACCGCTGCTGGTACCCGG - Intronic
914779864 1:150775514-150775536 GAGACACCGCTGCTCCAGCCTGG - Intergenic
915565900 1:156712542-156712564 CAGCCAGCACTGCTAGACCCAGG - Intergenic
916551430 1:165853481-165853503 CACCCACCCCCGCTCCAACCAGG + Intronic
919993676 1:202728077-202728099 CATCCACTGCTACTGCAACCTGG + Exonic
1062792547 10:318161-318183 CAGCCACCGCTGCCACACTTTGG + Intronic
1064329734 10:14382392-14382414 CAGCCACTGTTTCTACAGCCTGG - Intronic
1065192303 10:23224237-23224259 CAGCCTCCGCTGCTGATACCCGG + Intronic
1065910976 10:30305208-30305230 AAGCCACCACTGCCACCACCAGG + Intergenic
1070688381 10:78506897-78506919 CAGCCACCCCTAATACCACCAGG - Intergenic
1071524242 10:86348997-86349019 CAGCCACTGCTGCCACCACGCGG - Intronic
1072819511 10:98542187-98542209 CAGCCACCTCTGCTGATACCCGG + Intronic
1073074894 10:100817669-100817691 CAGCCCCCTCTGCTGGAACCTGG + Intronic
1074031899 10:109697258-109697280 CAGCTACTGCTGCTACTCCCAGG + Intergenic
1074531975 10:114304664-114304686 CAGCCACCACCGCCACACCCTGG + Intronic
1076361776 10:129894644-129894666 GAGCCATGGCTGCTGCAACCTGG - Intronic
1076737285 10:132464526-132464548 CAGCCACCCCTACCACACCCGGG - Intergenic
1077097628 11:805609-805631 CACCCACCCCTGCTACAAGCCGG + Intronic
1078147383 11:8730902-8730924 CAGCGACCCCTGCTACATCCTGG + Exonic
1078876761 11:15406989-15407011 CAGCCACTGCTGTTATAACGTGG + Intergenic
1079668109 11:23133819-23133841 CAGCCACCTCAGCTTCAGCCTGG + Intergenic
1080785233 11:35469393-35469415 CAGCCACTGCTGCCCCTACCTGG + Intronic
1080937889 11:36882563-36882585 CAGCCACCACTGCTTCTATCAGG - Intergenic
1083756736 11:64796037-64796059 CAACCACAGCTCCTACAACTTGG + Intronic
1083796826 11:65021744-65021766 CAGCCACCACTGGTGCATCCAGG + Exonic
1084402166 11:68950925-68950947 CATCCACCGCTGCTACAATGAGG - Intergenic
1085047773 11:73363357-73363379 CAGCCACGGCTCCTTCACCCGGG + Exonic
1085803911 11:79617262-79617284 CTGCCACAGGTGCTAAAACCTGG + Intergenic
1086052724 11:82613010-82613032 CAGCCTCCAATGATACAACCAGG - Intergenic
1093320178 12:17704665-17704687 CAGCCACTGCTGCTGATACCAGG - Intergenic
1093781929 12:23146689-23146711 CAGCCACCGCTGCTGATACCGGG + Intergenic
1101683865 12:106997293-106997315 CTTCCACTGCTGCTACAACCTGG + Exonic
1102349400 12:112181072-112181094 CAGCCTCCACTGCTTGAACCCGG + Intronic
1104674491 12:130703501-130703523 CACCCACTGCTGCGACCACCCGG + Intronic
1104916444 12:132267257-132267279 CATCCACCCCTGCCACAAGCTGG - Intronic
1105239902 13:18599513-18599535 CTGCCACCGCTGCTGCTTCCAGG + Intergenic
1106181666 13:27374545-27374567 CAGCCTCTGCAGCGACAACCAGG + Intergenic
1109619928 13:64890379-64890401 CTGCAACCTCTGCTGCAACCCGG - Intergenic
1114065282 14:19054593-19054615 CTGCCACCGCTGCTGCTTCCAGG + Intergenic
1114096980 14:19345409-19345431 CTGCCACCGCTGCTGCTTCCAGG - Intergenic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1115695831 14:35897897-35897919 TAGCCACTGCTGCTGCCACCAGG - Intronic
1118748348 14:68789896-68789918 CTGCCACCGCCGCTGCCACCGGG - Exonic
1122969922 14:105148383-105148405 CCGCGGCCGCTGCTACGACCTGG - Exonic
1123491336 15:20784549-20784571 CTGCCACCGCTGCTGCTTCCAGG - Intergenic
1123547838 15:21353640-21353662 CTGCCACCGCTGCTGCTTCCAGG - Intergenic
1125146060 15:36469982-36470004 CAGGCAGAGCTGCTACAAGCAGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1128573719 15:68755018-68755040 CTGCCTCCCCTGCTACAAACAGG - Intergenic
1132185926 15:99801576-99801598 CTGCCACCGCCGCTGCCACCAGG + Intergenic
1202956168 15_KI270727v1_random:80870-80892 CTGCCACCGCTGCTGCTTCCAGG - Intergenic
1136002119 16:27302803-27302825 CAGCCACCTCTGTAACATCCTGG - Intergenic
1138720439 16:59073102-59073124 CAGCCACTGCTGCTGATACCCGG + Intergenic
1146155686 17:30522403-30522425 CAGCCACCGCTTTCACACCCTGG + Exonic
1146594499 17:34157161-34157183 CAGCGGCCGCTGCTAGCACCGGG + Intronic
1152332217 17:79679844-79679866 CAGCCACTGCTCCTTCAGCCTGG - Intergenic
1152407300 17:80104979-80105001 CAGCTACCCCAGCTACAAGCTGG + Intergenic
1152516114 17:80825885-80825907 CAGCCCACCCTGCAACAACCAGG - Intronic
1153023968 18:657442-657464 CAGCCACCGCACCTGCATCCAGG + Intronic
1154448931 18:14459261-14459283 CTGCCACCGCTGCTGCTTCCAGG - Intergenic
1157354097 18:46917475-46917497 CGGCCGCCGCCGCTACAGCCGGG + Intronic
1160500231 18:79398018-79398040 CAGCCATCGCTGAGACCACCGGG + Intronic
1160910956 19:1473609-1473631 CAGCCACAGCAGCCACTACCGGG + Exonic
1163834873 19:19567161-19567183 CAACCAGGGCTGCTTCAACCAGG - Intronic
1167091797 19:47349380-47349402 CAGCCATCGCCGCCACAACCCGG - Intronic
1167171246 19:47833684-47833706 CACCCACCTCTCCTCCAACCTGG + Intronic
1167604926 19:50476552-50476574 CAGCCAGCGCTGGGGCAACCCGG + Exonic
930491812 2:52083218-52083240 CAGCTAGCTCTGCTCCAACCTGG - Intergenic
933083404 2:78023552-78023574 TAGCCACTGCTGCTGCCACCAGG - Intergenic
937083891 2:119158306-119158328 CCGCCGCCGCTGCCACAGCCGGG + Exonic
938583743 2:132669999-132670021 CAGCCACAGCCGCTGCAGCCGGG - Exonic
941811063 2:169756576-169756598 GAGCCACAGCTGCTACAGCCTGG - Intronic
942615405 2:177786248-177786270 CAGCCACCACTGCTGATACCAGG + Intronic
943929905 2:193836151-193836173 CAGCCTCCGCTGGTGAAACCCGG - Intergenic
946353934 2:219173065-219173087 CGGCCACCGATGCCACAGCCAGG + Exonic
946772207 2:223100353-223100375 CAGCCTCCTCTGTTACAAACTGG - Intronic
947242158 2:228006821-228006843 CAGCCTCCACTGCTATACCCAGG - Intronic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1170874804 20:20240471-20240493 CACCCACTGCTGCTAGACCCTGG + Intronic
1172523113 20:35582119-35582141 CAGCCACCTCCAGTACAACCTGG + Intergenic
1175172414 20:57089961-57089983 CAGGCACTGCTGCTATGACCAGG + Intergenic
1176447286 21:6831266-6831288 CTGCCACCGCTGCTGCTTCCAGG + Intergenic
1176825454 21:13696292-13696314 CTGCCACCGCTGCTGCTTCCAGG + Intergenic
1178265337 21:31137766-31137788 CAGCCATTGCTGCTTCAGCCTGG + Intronic
1180483773 22:15777213-15777235 CTGCCACCGCTGCTGCTTCCAGG + Intergenic
1181019913 22:20094319-20094341 CAGCCACTGCTGCTGCCACCTGG + Intronic
1181963890 22:26643115-26643137 CACCCACCGCTCCTACTTCCTGG + Intergenic
1184373396 22:44096983-44097005 CAGCAAGCGCTGCTCCATCCAGG - Intronic
954223084 3:49166303-49166325 CCGCCTCCGCTGCTCCAACATGG + Exonic
957886777 3:86297879-86297901 CAGCCTCCGCTGCTGATACCCGG + Intergenic
962205480 3:133430843-133430865 CAGCCTCCGCTCCTCCACCCTGG + Intronic
967735261 3:192945124-192945146 CAGCCATTGCTGCCACAACCAGG + Intergenic
969058469 4:4416517-4416539 CAGCCACAGCTGCCAAAACAGGG + Intronic
969240686 4:5895038-5895060 CACCCACCGCAGCTGCATCCTGG + Intergenic
970918203 4:21360945-21360967 CAGCATCCGCTGCTACACCCTGG + Intronic
984232119 4:177112176-177112198 CAGCCACGGCTGGAACAACTGGG + Intergenic
987234361 5:15928182-15928204 GTGCCGCCGCTGGTACAACCTGG + Exonic
989956594 5:50367612-50367634 CAGCCTCCGCTGCTGATACCCGG + Intergenic
990521873 5:56588769-56588791 CAGCCCCAGCAGCTACATCCTGG - Intronic
997151304 5:131498923-131498945 CTGCCACTTCTCCTACAACCAGG + Intronic
1002006427 5:176238396-176238418 CAGCGGCGGCGGCTACAACCCGG - Exonic
1002065312 5:176648680-176648702 CAGCCAGGCCTGCTACAGCCAGG - Intronic
1002219951 5:177672241-177672263 CAGCGGCGGCGGCTACAACCCGG + Intergenic
1002596677 5:180328374-180328396 CAGCAGCCGCTGCTGCAGCCTGG + Intronic
1004304335 6:14487052-14487074 CAGCCACCCAAGCCACAACCCGG + Intergenic
1016291228 6:142530413-142530435 CAGCCTCCACTCCTACTACCAGG - Intergenic
1017630246 6:156389878-156389900 CAGCCATCACTGCTAAAACAGGG + Intergenic
1020535370 7:9389767-9389789 CAGCCACTGTTGCTGCCACCAGG - Intergenic
1022690622 7:32648912-32648934 CAGCCACCCCTCCCCCAACCTGG + Intergenic
1022918179 7:34982754-34982776 CAGCCACCCCTCCCCCAACCTGG + Intronic
1024231489 7:47367169-47367191 CAGGCACAGCCGCTACAGCCTGG + Intronic
1026598288 7:71752548-71752570 CAGCCCTCCCTGCTACACCCCGG + Intergenic
1029887594 7:103889545-103889567 CAGTCACCGTTGATACAAACGGG + Intronic
1031920333 7:127595615-127595637 CATCCACCGCTGCTATGCCCGGG + Exonic
1034525005 7:151653436-151653458 CACCCACCGATACGACAACCTGG + Intronic
1036649626 8:10634042-10634064 CAGCCTCAGCTCCTACAACAAGG + Intronic
1043376153 8:79652032-79652054 CAGCCACAGCTGCTAAAGGCAGG - Intronic
1047403179 8:124562898-124562920 CCGCTACCGCAGCTCCAACCTGG - Exonic
1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG + Intronic
1050178921 9:2899330-2899352 CAGCCACCGCTGCTGATACCAGG - Intergenic
1051310188 9:15762786-15762808 CAGTCACCCCTGCTCCTACCTGG + Intronic
1053007213 9:34612266-34612288 CAGCCTCCGCTGTTACGCCCCGG + Intergenic
1056126294 9:83538645-83538667 CAGCCGCCGCTGCGTCAAGCTGG + Intergenic
1056706141 9:88954033-88954055 CAGCCACAACAGCTGCAACCTGG + Intergenic
1056930002 9:90866351-90866373 CAGCCTCCCCTGTTTCAACCTGG - Intronic
1057197626 9:93123720-93123742 CCTCCACCTCTGCTACAAACCGG + Intronic
1057504123 9:95618522-95618544 AAGCCACCACTGCTCCAGCCTGG - Intergenic
1057758076 9:97853096-97853118 CCGCCACAGCTGCTCCTACCTGG + Intergenic
1057879120 9:98779986-98780008 CAGCCACTGTTGCCACAACATGG + Intronic
1057932966 9:99212091-99212113 CAGCCACTGCTGCTGCCACTGGG - Intergenic
1058305746 9:103438815-103438837 CAGCCTCCGCTGCTGATACCCGG - Intergenic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1062425805 9:136505695-136505717 CGGCAACCCCTGCTACAACCAGG - Exonic
1203521904 Un_GL000213v1:53265-53287 CTGCCACCGCTGCTGCTTCCAGG - Intergenic
1186433392 X:9523352-9523374 CAGCGACTGGTGCCACAACCTGG + Intronic
1189702018 X:43721540-43721562 GAGCCACCACTGCTATAGCCTGG + Intronic
1191976166 X:66873779-66873801 CTGCCACCACTGCTACCATCTGG + Intergenic
1193071976 X:77315508-77315530 CAGCCACCGCTGGTAATATCAGG + Intergenic
1199578838 X:149341383-149341405 CAGACACAGCTGATACAAGCAGG - Intergenic
1199675568 X:150186456-150186478 CAGCCACCTGTGGTACAATCTGG + Intergenic
1200321942 X:155198469-155198491 CAGCCACTGCTGCTGATACCAGG + Intronic
1202601993 Y:26602624-26602646 CAGACACCGCTGCTGATACCAGG + Intergenic