ID: 912415141

View in Genome Browser
Species Human (GRCh38)
Location 1:109503146-109503168
Sequence CAGTATTTTCATGTTGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 524}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912415141 Original CRISPR CAGTATTTTCATGTTGTAAA TGG (reversed) Intergenic
903022231 1:20402338-20402360 CAGTTTTTTCATCTGCTAAATGG - Intergenic
903692533 1:25184413-25184435 CATTGTCTTCATGTGGTAAATGG + Intergenic
903873245 1:26452629-26452651 CAGTATTCTCATCTTTAAAATGG - Intronic
904249313 1:29211626-29211648 CAGTTTTTTCATCTCGAAAATGG - Intronic
904574858 1:31498811-31498833 CAGTTTTTTCATCTGGAAAATGG - Intergenic
904680188 1:32223588-32223610 CAGTTTTCTCATCTTGAAAATGG - Intronic
905110368 1:35590338-35590360 CAGTGTTTGGATGTGGTAAAGGG + Intronic
905514381 1:38551229-38551251 CAGATTTTTCTTGTTCTAAAGGG - Intergenic
905836580 1:41128457-41128479 CAGCATTTTTAAGTTCTAAAAGG - Intronic
906148119 1:43571894-43571916 CAGTTTTCTCATGTTTGAAAAGG + Intronic
906829262 1:49014446-49014468 GATTATTTTCATGTTATAAAAGG - Intronic
907930614 1:58995895-58995917 CTGGATTTGCATGTTTTAAAGGG + Intergenic
908781181 1:67691978-67692000 CAGTATTTTCACCTTCAAAATGG - Intergenic
909873500 1:80775374-80775396 CTGATTTTTCATGTTGTAAATGG - Intergenic
910032580 1:82747556-82747578 TAGTAATTTTATATTGTAAAGGG - Intergenic
910081363 1:83346146-83346168 CACTATTCTCATTTTTTAAAAGG + Intergenic
910199211 1:84681122-84681144 CAGTAGTTTGTTGTTTTAAAGGG + Intronic
910519952 1:88109148-88109170 AAGCATTTTCATTCTGTAAAAGG + Intergenic
910813405 1:91261951-91261973 CAGTATGTTAATTTTGTAAAGGG - Intronic
912076518 1:105882770-105882792 CAGTTTTTTCATAGTGTCAATGG + Intergenic
912185490 1:107270454-107270476 CAGTTTTCTCATGTTTGAAATGG + Intronic
912371971 1:109180660-109180682 GAGTATTTTCATATTAAAAAAGG - Intronic
912415141 1:109503146-109503168 CAGTATTTTCATGTTGTAAATGG - Intergenic
912951198 1:114121738-114121760 CAGTATTTCCATTTTATAGATGG - Intronic
913173674 1:116255025-116255047 CAATGATTACATGTTGTAAAAGG - Intergenic
913271511 1:117098317-117098339 CAGAATATTCAAGTTGAAAAAGG + Intronic
913401111 1:118434186-118434208 CAGAACTTGCATGTAGTAAAAGG + Intergenic
913484454 1:119321060-119321082 CAGTATTTTCTTCTCTTAAATGG - Intergenic
913683984 1:121214321-121214343 CAGTTTTCTCATATTTTAAATGG - Intronic
913689872 1:121268978-121269000 CAGCATTTAGATGTTGGAAAAGG + Intronic
914035824 1:144001936-144001958 CAGTTTTCTCATATTTTAAATGG - Intergenic
914147728 1:145011294-145011316 CAGCATTTAGATGTTGGAAAAGG - Intronic
914153632 1:145066009-145066031 CAGTTTTCTCATATTTTAAATGG + Intronic
915804608 1:158831432-158831454 GACTATTTTAATCTTGTAAAGGG - Exonic
916281538 1:163056963-163056985 CAGCATTTTTTTTTTGTAAAAGG + Intergenic
916478465 1:165192804-165192826 CATTATTTTCCTGTTATACAAGG + Intergenic
916872959 1:168937538-168937560 CAGTATTTTCCTGTTGGACAAGG + Intergenic
917023162 1:170612604-170612626 CAGTTTCTTCATTTTGTCAATGG + Intergenic
917474871 1:175360706-175360728 CAATATTTTCATGTTAAAATTGG + Intronic
917544064 1:175944061-175944083 AATTATTTTCAAATTGTAAAAGG - Intergenic
918171279 1:181999722-181999744 CAGTTTCTGCATGTTTTAAATGG + Intergenic
918303024 1:183220987-183221009 TAGTTTTTTAATGTTGTACAGGG + Intronic
918389331 1:184041498-184041520 AAGGATTTTCATGTTGAAATTGG - Intergenic
919141277 1:193574756-193574778 CAGTTTCTTCATGGTGTCAATGG - Intergenic
919980802 1:202642119-202642141 CAGTATCTTCATCTGGAAAATGG - Intronic
920041821 1:203102960-203102982 CAGTTTTCTCATTTTGGAAATGG + Intronic
920321058 1:205122924-205122946 CAGCATTTTCATGTTGCCCAGGG + Intergenic
920471289 1:206232813-206232835 CAGTTTTCTCATATTTTAAATGG - Intronic
920477195 1:206287455-206287477 CAGCATTTAGATGTTGGAAAAGG + Intronic
921528970 1:216255957-216255979 AAGTAATTTCATTTTGCAAAAGG - Intronic
921713989 1:218400183-218400205 CCATATTTTCATATTGAAAAAGG - Intronic
923318213 1:232802531-232802553 CATTATTTTCAATCTGTAAAAGG - Intergenic
923377152 1:233375369-233375391 AAATATTTTCAAGTTTTAAAAGG + Intronic
924092621 1:240517141-240517163 CAGTTTTCTCATGTGGAAAATGG - Intronic
924206098 1:241712784-241712806 CAGTCTTTTCATGTTGCCTAGGG - Intronic
924416205 1:243859344-243859366 AAGTAATTTCATGGTGTAATGGG + Intergenic
924444331 1:244115199-244115221 CAGGATTATCCTGTAGTAAAGGG - Intergenic
924774584 1:247106992-247107014 AAGTATTTTAATATTTTAAAAGG - Intergenic
1063066279 10:2612444-2612466 CTGTATTTTGATGTTTTCAAAGG - Intergenic
1064228314 10:13506733-13506755 CAGGATTTTCAGGATGGAAATGG + Intronic
1065474384 10:26118549-26118571 CATTATTTTTGTGTTTTAAATGG - Intronic
1065987462 10:30969328-30969350 CAGTGTTTTCATATACTAAATGG + Intronic
1066284550 10:33951925-33951947 CAGTAATTGAATGTTTTAAATGG + Intergenic
1068036099 10:51761570-51761592 CAGTATTTTTATGCTTTCAAAGG + Intronic
1068208247 10:53885599-53885621 TAGAATTTTCTTGTTGTCAATGG - Intronic
1068264947 10:54634498-54634520 ATGTATTTTCATTTTGGAAATGG + Intronic
1068756949 10:60666469-60666491 AACTCTTTTCATGTTGCAAATGG - Intronic
1069155222 10:65021203-65021225 CAGTTTTTTCATGTGTTAAAAGG - Intergenic
1069255575 10:66328246-66328268 TATTATTGTCATGTTATAAATGG + Intronic
1069626622 10:69871890-69871912 CAGTGTTTTCATCTTGAAAATGG - Intronic
1070358729 10:75666097-75666119 AAGAATTTTCATGCTGTTAAAGG - Intronic
1071720131 10:88135400-88135422 CAGTATTTTCATCTGAAAAATGG - Intergenic
1071985591 10:91047117-91047139 AAGTATGTTCCTTTTGTAAAGGG + Intergenic
1072524039 10:96255751-96255773 CTGCATTTTCCTGTTGTAAAGGG - Intronic
1072780144 10:98244846-98244868 CAGTAATACCATGTTGTAAGAGG + Exonic
1075208020 10:120463459-120463481 CAGTTTCTTCATGTAGGAAATGG + Intronic
1076251258 10:128985424-128985446 CAGTGTTCTCATGTGTTAAATGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077277211 11:1718351-1718373 CAGCATATTAATGATGTAAAAGG + Intergenic
1077748696 11:4938600-4938622 GAGTATTTTCATGTAGTCAAAGG - Intronic
1078269210 11:9779137-9779159 AAGTATTTTTATTTTTTAAAAGG + Exonic
1079446837 11:20564811-20564833 CAGTTTTCTCATCTTTTAAATGG + Intergenic
1079962175 11:26938286-26938308 CACTTTTTGCAAGTTGTAAATGG + Intergenic
1080615277 11:33940296-33940318 CAGTTTCTTCATCTGGTAAATGG - Intergenic
1081363500 11:42207391-42207413 CAGTTTCTTCATATTGTCAATGG - Intergenic
1081598999 11:44479341-44479363 AAGTATTTGCTTTTTGTAAAAGG - Intergenic
1083085626 11:60141346-60141368 CAGTATTTATATTTTTTAAAAGG + Intergenic
1083126728 11:60576345-60576367 CAGTATGTTCATTTTGTGATTGG - Intergenic
1084536204 11:69758692-69758714 CAGGATTTTCATGTCCTGAAGGG - Intergenic
1085912787 11:80848312-80848334 CAGTATTTTCATTTGAAAAATGG + Intergenic
1085958006 11:81424522-81424544 CAGGTTTTCCATGATGTAAACGG - Intergenic
1086019265 11:82206607-82206629 CATTGTTTTCATTTTGTAGAAGG - Intergenic
1086238121 11:84657030-84657052 CAGTTTTGTCATATGGTAAATGG - Intronic
1086433467 11:86758591-86758613 CAGCAATGTCATGTTGCAAAAGG + Intergenic
1086898822 11:92343238-92343260 CAGTATTATTATGATGAAAAAGG + Intergenic
1087172459 11:95064027-95064049 CAGGCTATTCATCTTGTAAATGG + Intergenic
1087305960 11:96489017-96489039 CAGTTTCTTCATATTGTCAATGG - Intronic
1087488544 11:98791247-98791269 CAGTATTTTGAGGATGTGAAGGG - Intergenic
1087704592 11:101475800-101475822 CAGGATTTTCTTCTTTTAAAAGG + Intronic
1088190689 11:107225089-107225111 CACTATTTTCAGGCTGGAAATGG - Intergenic
1088217107 11:107523297-107523319 AAGTTTATCCATGTTGTAAATGG - Intronic
1091061192 11:132463956-132463978 CAGTTTCTTCATCCTGTAAATGG + Intronic
1093215301 12:16355038-16355060 AAATATTTTAATTTTGTAAAGGG - Intronic
1093382526 12:18510547-18510569 CAGTGTTTTCATATTCTATATGG + Intronic
1093588828 12:20874450-20874472 CAGTATGTTCATGGAGAAAAAGG + Intronic
1094730174 12:33165343-33165365 CAGTTTCTTCATGGTGTCAATGG - Intergenic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1095451271 12:42333152-42333174 CAGTCTTTTCATATTGTTACTGG + Intronic
1095663078 12:44760835-44760857 CAGTGTTGTCATGCTTTAAAAGG - Intronic
1098800002 12:74944201-74944223 CAATCTTTTCACGTTGTAAAGGG + Intergenic
1098889784 12:75997983-75998005 CAGAATCTTCATCTTGAAAATGG - Intergenic
1099327212 12:81232646-81232668 CAGTATTCTCATCTGTTAAATGG - Intronic
1099770710 12:87050957-87050979 ATGTATTTTCAAGTTATAAAAGG + Intergenic
1101112193 12:101496995-101497017 CATAAATTTCATGTGGTAAAAGG - Intergenic
1101418205 12:104527041-104527063 CAGTCCTTTCATGGTGTAACGGG + Intronic
1101584314 12:106071221-106071243 CAGTATTCTCATCTTTTAAATGG - Intronic
1102428268 12:112861651-112861673 CAGTTTTCTCATGTAGTAAATGG + Intronic
1102456661 12:113075173-113075195 CAGTTTTCTCATGTTGAAAATGG - Intronic
1102925559 12:116823363-116823385 CCCTGTTTTCATGTTATAAATGG + Intronic
1104461013 12:128955938-128955960 CAGTATTTTCAACTTGTGATGGG - Intronic
1104570717 12:129922933-129922955 CAGGGTGTTAATGTTGTAAAAGG + Intergenic
1105732824 13:23236187-23236209 CAGGATTTCCCTTTTGTAAAAGG + Intronic
1105829513 13:24151353-24151375 CATTATTTTCATTTTACAAATGG - Intronic
1106390818 13:29334284-29334306 CAGTTTCTTCATGGTGTCAATGG + Intronic
1106666641 13:31858270-31858292 CACTATTTTCATGATCTAAAAGG + Intergenic
1106891195 13:34247552-34247574 CAGAATGTTCATGTTGTTACCGG + Intergenic
1106985898 13:35349391-35349413 GAATGTTTTCATGCTGTAAATGG - Intronic
1107473199 13:40710593-40710615 CAGTTTCTTCATGGTGTCAATGG + Intergenic
1108642811 13:52398092-52398114 CAGTATTTTGATGGTGCTAATGG - Exonic
1108686047 13:52819260-52819282 CAGGATTTTCATGTGTTAATGGG + Intergenic
1108903775 13:55445755-55445777 CAGGTTTTTCATCTTGAAAACGG + Intergenic
1109144044 13:58755175-58755197 CAGAATTTTCTTCTTGTATAAGG + Intergenic
1109891425 13:68619015-68619037 CAGTTTTTTCATAGTGTCAATGG - Intergenic
1111895213 13:94133523-94133545 CTCTATTTTCATTTTGCAAAGGG - Intronic
1112114888 13:96340950-96340972 CAGTCTTTTCTGGTTGTACATGG + Intronic
1113079753 13:106506308-106506330 CACTATTTTCATTGTGTAACAGG + Intronic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1114461744 14:22890722-22890744 CTGTATTTTCATTTTGCAAGGGG + Intergenic
1114628453 14:24144647-24144669 CAGTTTTTTCATCTGTTAAATGG - Intronic
1114885607 14:26846225-26846247 CAGTATTTTTATTTTGGAAGAGG + Intergenic
1115672818 14:35634747-35634769 CTGTATTTTCAGGTTTTACATGG - Exonic
1115684600 14:35782826-35782848 CAGTATTTTTTTTTTTTAAATGG + Intronic
1115911950 14:38267021-38267043 CAGTTTTTTCATAGTGTCAATGG + Intergenic
1116095854 14:40366148-40366170 CATTCTTTACATGTTGTACATGG + Intergenic
1116686001 14:48039452-48039474 CAAGATTTTCATGTTCTAGAAGG - Intergenic
1117516100 14:56503086-56503108 CACCATATTCATGTTGTAAACGG - Intronic
1117782494 14:59248699-59248721 CATTATTTTTATTTTGTATAGGG + Intronic
1118480995 14:66165725-66165747 CAGTAATGTTATTTTGTAAAGGG - Intergenic
1118850443 14:69579023-69579045 CAGTATTTGCAAGTTCTTAAGGG + Intergenic
1119797925 14:77416113-77416135 CAGTATTGTCTTTTTGTACATGG + Intronic
1120603961 14:86548976-86548998 TCGTACTTTCATGTTGTGAAAGG + Intergenic
1121458813 14:94057400-94057422 CAGTTTTCTCATGTATTAAATGG - Intronic
1121666840 14:95678967-95678989 TTGTAATTTCATGTTGTGAAAGG + Intergenic
1124496496 15:30190863-30190885 CAGTATCTTCATCTGGAAAATGG - Intergenic
1124747079 15:32347785-32347807 CAGTATCTTCATCTGGAAAATGG + Intergenic
1124830884 15:33148350-33148372 CAGTATTTTCCTGTTCTTTATGG + Intronic
1125231127 15:37457352-37457374 AATTATTTTCAGCTTGTAAATGG - Intergenic
1125879425 15:43180423-43180445 TAGTATTTGCATTTTGCAAACGG + Intronic
1126306668 15:47266502-47266524 CAGTGGTTCCATGTTGGAAAAGG - Intronic
1126953564 15:53909966-53909988 CTGTATTTTCATGTTTTAAGTGG + Intergenic
1127268438 15:57379786-57379808 CAGGATTTTCATGTCATAACTGG - Intronic
1127489004 15:59444365-59444387 AGGCATTTTCATGTTGTAAGTGG + Intronic
1127662672 15:61114879-61114901 TAATATTTTGATGTCGTAAATGG - Intronic
1128669290 15:69562398-69562420 AAGCATTCTCGTGTTGTAAAGGG + Intergenic
1129301272 15:74626968-74626990 CTGCATTTTCATTTTGCAAAGGG + Intronic
1129897111 15:79116674-79116696 CAGTGTTTTCCTGTTGCAGATGG + Intergenic
1131685752 15:94765960-94765982 CATTATTTTCATCTTGTCGATGG + Intergenic
1132920772 16:2390643-2390665 CAGTATTTCCAGTTTGGAAAAGG - Intergenic
1133679976 16:8112363-8112385 CAGTGTTCTCATCTTGAAAATGG - Intergenic
1134206847 16:12245266-12245288 CAGTATTTTCATCTGTTAAATGG + Intronic
1134300545 16:12986798-12986820 CAGTATTTTCATCTTTAAATTGG - Intronic
1135246172 16:20858985-20859007 CTGTATTTTCATGTTGTAAGTGG - Exonic
1135274563 16:21101057-21101079 CAGTATTTTCAAATTGCAATAGG - Intronic
1138063907 16:53920699-53920721 CAGTTTTTTCATCTTTAAAATGG + Intronic
1138663160 16:58538466-58538488 AAGTATTTTAATGTCTTAAATGG - Intronic
1138835171 16:60425836-60425858 CAGTATTTCCATGATGGAAAAGG + Intergenic
1138963947 16:62060867-62060889 CAATATTTACTTTTTGTAAATGG - Intergenic
1139324570 16:66142270-66142292 CAGTTTTTTCATCTGTTAAATGG + Intergenic
1140157210 16:72443571-72443593 CAGAATTTTCATTTTAAAAAGGG - Intergenic
1140786386 16:78346305-78346327 CAGTTTTTAGCTGTTGTAAATGG + Intronic
1141291992 16:82726859-82726881 CAGTGTTTTCATCTGGGAAATGG - Intronic
1141320673 16:83005537-83005559 CAGTGTTTTCCAGTTGTGAAGGG + Intronic
1141783311 16:86179924-86179946 CAGTATTTTCATCTTGCGGAAGG + Intergenic
1142369533 16:89670440-89670462 TAGTATGTTCATGTTGGAAGTGG + Exonic
1143726946 17:8854890-8854912 CCGTTTTTTCATTTTGTTAAAGG - Intronic
1145199206 17:20925826-20925848 CAGTATTTGCCTTTTGTAAATGG + Intergenic
1146195008 17:30804047-30804069 CAGCATTTTAATGATTTAAAGGG - Exonic
1146583608 17:34061804-34061826 TAATATTTTCTTGTTGTACAAGG - Intronic
1147837599 17:43345895-43345917 CTGTATTTTCATGTTGTAAGTGG + Intergenic
1148047343 17:44752233-44752255 CAGTATTTTATTATTGGAAAGGG - Exonic
1149414214 17:56441819-56441841 CAATGTTTTAATGTTGAAAATGG - Intronic
1153030092 18:705668-705690 CACTATTTTCATGGCGAAAAGGG - Intronic
1153600121 18:6772698-6772720 CAGTATTTTCAATTTGTGATGGG + Intronic
1155362888 18:25019487-25019509 AAGTGTTTTCAGCTTGTAAACGG - Intergenic
1155984653 18:32217401-32217423 CAGTATCTTCATCTAGAAAATGG - Intronic
1156647826 18:39187877-39187899 CATTATGTTCATATTGTGAAAGG - Intergenic
1156798150 18:41074161-41074183 CAGTTTTTTCATCTGTTAAATGG + Intergenic
1157149364 18:45200342-45200364 CAGGATTTTGATGTTCAAAATGG + Intergenic
1158059294 18:53319175-53319197 CAGTTTCTTCATGGTGTCAATGG - Intronic
1158472778 18:57752424-57752446 CATTATCTTCATGTTATAAATGG - Intronic
1160280297 18:77484009-77484031 CAGTATTAACATGATGTGAAAGG + Intergenic
1161090009 19:2355067-2355089 CTCTATTTTAATTTTGTAAAAGG - Intergenic
1164230289 19:23281174-23281196 CACTATTTTCATGTAAAAAAAGG - Intergenic
1164964246 19:32467200-32467222 CAGCACTTTCATATTGTTAAAGG + Intronic
1166686248 19:44798139-44798161 CAGTGTTTTCATGGGGAAAATGG + Intronic
926575642 2:14577429-14577451 GATTATTTTCATGTTAAAAAGGG + Intergenic
926975226 2:18509169-18509191 CAGTATAATCATTTTTTAAAAGG + Intergenic
927588072 2:24328112-24328134 CAATATTTTTATGTTGCAGATGG - Exonic
928204606 2:29275048-29275070 CAGTAACTTCTTGTTGCAAAAGG - Intronic
928372024 2:30747126-30747148 CAGTCTTTTCACGTAGTAGAAGG + Intronic
929169041 2:38912841-38912863 CAGTATTCTCATCTAGAAAATGG + Intronic
929982516 2:46695118-46695140 CAGTACTTATATGTTGTACAAGG - Intergenic
930357579 2:50341477-50341499 TTGTATTTTCATTTTATAAATGG + Intronic
930637094 2:53818795-53818817 CAGTGTTGTCATGTAGTCAATGG + Exonic
931164300 2:59729920-59729942 TACAATTTTCCTGTTGTAAAGGG - Intergenic
932979418 2:76646406-76646428 GAATATTTTCATGTGGTTAATGG - Intergenic
933222111 2:79702343-79702365 CTTTATTTTCATGTTGTATATGG + Intronic
933929039 2:87129785-87129807 CAGTATTTTCTTCTAGGAAATGG - Intergenic
934000373 2:87705570-87705592 CAGTATTTTCTTCTAGGAAATGG - Intergenic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
935473901 2:103494405-103494427 CAACATTTTCATGATTTAAAGGG + Intergenic
935545887 2:104399175-104399197 CAGTATATTCTGGTTGTAAAGGG + Intergenic
935745135 2:106183805-106183827 GAGTATTTTCATTTTACAAATGG + Intronic
935952453 2:108343566-108343588 CAGCATTTTCTTGTTTGAAAAGG + Intergenic
936363901 2:111833603-111833625 CAGTATTTTCTTCTAGAAAATGG + Intronic
937246658 2:120498392-120498414 CAGTTTATTCATCTTGAAAATGG - Intergenic
937725627 2:125162080-125162102 TAGTAGTTACATGTTGTACAAGG + Intergenic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
938202437 2:129385556-129385578 CAGTAATTATATCTTGTAAATGG - Intergenic
939689459 2:145239628-145239650 CATTATTTTTATGGAGTAAATGG - Intergenic
939876483 2:147584519-147584541 CAGTTTCTTCATAGTGTAAATGG + Intergenic
940364055 2:152826418-152826440 TAGTATTTTCATGTACAAAATGG - Intergenic
940812089 2:158256297-158256319 CAGTTCTTTCATGTGTTAAAGGG + Intronic
941320424 2:164047823-164047845 CAGTTTTTTCAAGTGGAAAATGG + Intergenic
941601992 2:167554158-167554180 CAGTTTTCTCATATTGAAAATGG + Intergenic
941647198 2:168053531-168053553 CTGTATTTTCAAGCCGTAAATGG - Intronic
941736961 2:168988427-168988449 CAGTATTTTCTTCTTTTTAAAGG + Intronic
942201672 2:173577630-173577652 CAGTTTTTTCATCTGGAAAATGG - Intergenic
942876741 2:180809177-180809199 CAGTTTTCTCATCTGGTAAATGG + Intergenic
943164666 2:184305480-184305502 CAGTGTTTACATGTAGTACAGGG - Intergenic
943482095 2:188431704-188431726 AAGTATGAGCATGTTGTAAATGG - Intronic
943888564 2:193255608-193255630 CATTATTTTGAAGTTGAAAATGG - Intergenic
944347610 2:198686844-198686866 CAGTGTCTTCATGGTGTCAATGG - Intergenic
944421893 2:199539910-199539932 GAGTATTTTCATCTGCTAAATGG + Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
945427956 2:209730584-209730606 CAGTGTCTTCCTGTTGCAAATGG - Exonic
945478216 2:210311888-210311910 CAGTATTTTGTTGTTGAAAAGGG + Intronic
945582314 2:211610770-211610792 CAATATTTGCATTTAGTAAATGG - Intronic
946055885 2:216901578-216901600 CAGTATTCTAAGGCTGTAAACGG - Intergenic
946639759 2:221771353-221771375 CTGTATTTATATGTTCTAAAAGG + Intergenic
946646381 2:221840183-221840205 CCGTATTTTGATTTTGTATATGG + Intergenic
946761591 2:222999344-222999366 AAGTCTTTTCATATTGTCAAAGG + Intergenic
947082714 2:226416907-226416929 CAGTAAATTCCTGTTGTTAAAGG - Intergenic
947193001 2:227529107-227529129 CAGTAGTTTCTTCTTGTAACAGG - Intronic
948422503 2:237868964-237868986 CAAATTTTTCGTGTTGTAAATGG + Intronic
1169101372 20:2952814-2952836 CAATATTTTCATTTTGTGACTGG + Intronic
1169448782 20:5693804-5693826 CATTATTTTGAAGTAGTAAAGGG - Intergenic
1169577593 20:6982478-6982500 CTGTATTTTCAAATTATAAAGGG - Intergenic
1169687570 20:8292485-8292507 CAGTTTGTTCATGTTTAAAATGG + Intronic
1169702541 20:8464208-8464230 TAATATTTTCATGTTGTATTGGG + Intronic
1170012411 20:11739418-11739440 CAGTTTCTTCATATTGAAAATGG + Intergenic
1170618302 20:17972493-17972515 CAGTATTCTCATGATGGAACTGG - Intronic
1170998309 20:21387671-21387693 CAGTATTTACATGCTCTTAATGG + Intronic
1171069040 20:22048428-22048450 CAGCTGTGTCATGTTGTAAAAGG + Intergenic
1171165815 20:22969501-22969523 TAGTATTTTCCTGTTGTACAAGG - Intergenic
1171200823 20:23240798-23240820 CAGTTTTTACTTGTTGCAAATGG - Intergenic
1171285464 20:23934498-23934520 CAGTTTTTTCATTTTTAAAAAGG + Intergenic
1172018108 20:31891703-31891725 AATTATTTTTAAGTTGTAAAGGG - Intronic
1172361181 20:34313536-34313558 CAGTTTTTCCATGTGTTAAATGG - Intergenic
1173221087 20:41133815-41133837 CAGTTTTTTCATCTGGAAAATGG + Intergenic
1173624667 20:44463864-44463886 CAGTGTTTTCATGTGTAAAATGG + Intronic
1173791723 20:45832416-45832438 CAGTTTCTTCATCTTGAAAATGG + Intronic
1174817578 20:53699927-53699949 CAGTTTTTTAATGTATTAAATGG + Intergenic
1175090125 20:56495820-56495842 CAGTATTTTCTCTTTGTAAAAGG - Intronic
1175449829 20:59054228-59054250 TGGTATTTTCATTTTCTAAAGGG - Intergenic
1176641898 21:9312799-9312821 CAGTTTTTTCATTGTGTCAATGG - Intergenic
1177817176 21:25990033-25990055 CTGTATTTTCTTGTTATAAATGG - Intronic
1177939165 21:27387211-27387233 CAATATTTTTAAGTTCTAAAAGG - Intergenic
1178113722 21:29395930-29395952 CAGTATTTTTATGTTTGAATAGG - Intronic
1178664625 21:34535793-34535815 CTCTATATTCATGTTGTTAAAGG + Intronic
1178874394 21:36402136-36402158 CACTATTTTCTTTTTTTAAAGGG + Intronic
1178940905 21:36904657-36904679 CAGAATTTTTATGTTGTCCAGGG - Intronic
1178971840 21:37185998-37186020 CAGTATTTTTATATTGACAATGG - Intronic
1180350911 22:11802152-11802174 CAGTTTTTTCATTGTGTCAATGG - Intergenic
1181365860 22:22376621-22376643 AAGTACTTTCTAGTTGTAAAAGG + Intergenic
1181372297 22:22428150-22428172 AAGTACTTTCTAGTTGTAAAAGG + Intergenic
1183219510 22:36503670-36503692 CAGTATTCTCATGTCTAAAATGG - Intronic
949108324 3:226925-226947 AAATATTTTCTTGTTGAAAATGG + Intronic
949222496 3:1652659-1652681 CAGTTTTTTCATAGTGTCAATGG + Intergenic
950817727 3:15724261-15724283 CAATGTTTTCATGTTTTAATTGG - Intronic
951079794 3:18439809-18439831 CAGTATTTTGATGTTTCAAAGGG + Intronic
951242117 3:20298890-20298912 CAGGATTTTCATCTTTTTAAAGG + Intergenic
952118072 3:30207822-30207844 TCATATTTTCATATTGTAAATGG - Intergenic
952718609 3:36508995-36509017 CAGTTTCTTCATGGTGTCAATGG + Intronic
953813394 3:46133352-46133374 CAGTGACTTCATGTTGTCAATGG + Intergenic
954782087 3:53069359-53069381 CAGTATTTTTAACTTGTAAAGGG + Intronic
954899323 3:54005617-54005639 CAGTATTCTCATCTTTGAAAGGG + Intergenic
954945899 3:54424174-54424196 CTGTATTTTCATTTTGTACTGGG + Intronic
955555613 3:60133888-60133910 CAGTATTTTCTTTTTTTCAAGGG - Intronic
955773566 3:62410607-62410629 CAGTTTTTTCATCTGGTAAGTGG + Intronic
955905915 3:63807380-63807402 CAGCATTCTCATGTGGAAAATGG - Intergenic
956336107 3:68165917-68165939 CAATATTTCCATATTTTAAATGG + Intronic
957324374 3:78673885-78673907 CAATATTTGCAGTTTGTAAATGG - Intronic
957617576 3:82551105-82551127 CAAAATGTCCATGTTGTAAATGG + Intergenic
957642325 3:82871469-82871491 CAGTATTTTCATAGAATAAATGG - Intergenic
958450824 3:94270368-94270390 CAGAAGATTAATGTTGTAAAAGG - Intergenic
958584910 3:96074626-96074648 CTTTTTTTTCTTGTTGTAAATGG + Intergenic
959126713 3:102298855-102298877 CAGTATTTTCAACGTGTAATTGG + Intronic
959154924 3:102655278-102655300 CATTAATTCCACGTTGTAAAGGG + Intergenic
960481792 3:118200325-118200347 GAAAATTTTCATGTTATAAAGGG - Intergenic
961765505 3:129207321-129207343 CAGTATTTTCCTTTTGTGACTGG + Intergenic
962431551 3:135325186-135325208 CAGTATTTGGTTGTTTTAAAAGG - Intergenic
962504738 3:136034933-136034955 TGGTATTTTCCTGTTGGAAAAGG + Intronic
963146071 3:141996258-141996280 AAGTATTTTCATGTAAAAAAAGG + Intronic
963860333 3:150303355-150303377 CATAATTTTCCTGATGTAAACGG - Intergenic
963888620 3:150608370-150608392 CAGTATTTTTTTCTTCTAAATGG - Intronic
963888769 3:150610012-150610034 CATTAGTTTAATGTTTTAAAAGG + Intronic
963905822 3:150772970-150772992 CAGTATCTTCATCTGGAAAATGG + Intergenic
964257709 3:154795870-154795892 CAGAACTTTCATGTTGCATAAGG - Intergenic
965182048 3:165416349-165416371 CAGTATTTGCATGTCTGAAAAGG - Intergenic
965744324 3:171907964-171907986 CAGTATTTTTGTGTAGTTAAGGG - Intronic
966018113 3:175168483-175168505 CAGTATCTTCAGGTTTAAAATGG + Intronic
966103285 3:176302616-176302638 CAGTATTTTCTTTTTGTGATTGG + Intergenic
966283737 3:178268083-178268105 CATTATTTTCTTGTAGTATATGG - Intergenic
966472199 3:180303327-180303349 CAGTTTTCTCATGTTTAAAAAGG - Intergenic
966752094 3:183331886-183331908 AAGTACTTTCATGTAGTAAATGG - Intronic
967466933 3:189817916-189817938 AAGTATTTACATTTTTTAAATGG - Intronic
967670347 3:192226383-192226405 CAGCATGTTCATGTTTCAAATGG - Intronic
967717913 3:192784309-192784331 CATTATTTTCAAATTGTAAATGG + Intergenic
968239333 3:197062127-197062149 CAGTATTTTCAACTTGTGATGGG - Intronic
1202744995 3_GL000221v1_random:92219-92241 CAGTTTTTTCATTGTGTCAATGG + Intergenic
969947113 4:10795063-10795085 TAGTATTTTCCTGTTGGACAAGG + Intergenic
969978574 4:11130504-11130526 CAGTTTTCTCATGATGTAGAAGG - Intergenic
971032015 4:22648551-22648573 CAGAATTTTCTTCTTGTTAAAGG + Intergenic
971496621 4:27273604-27273626 TAGTATTTACCTGTTGTCAAAGG + Intergenic
971661097 4:29417131-29417153 TAGTATTTTCATTTTGTACTTGG + Intergenic
971988924 4:33865998-33866020 CAGTTTCTTCATATTGTCAATGG - Intergenic
972013983 4:34220979-34221001 CATTATTTTCATCTTATAACTGG + Intergenic
972578980 4:40378503-40378525 CATTATTATCATGTTATTAAAGG + Intergenic
972669193 4:41197477-41197499 CTGTATTTTCATCTTTTAAGTGG - Intronic
972968576 4:44544178-44544200 CAGTATCTTTATGTCTTAAATGG - Intergenic
973832577 4:54776415-54776437 CAGTCTTTTCATCTGTTAAATGG - Intergenic
974369967 4:61003320-61003342 CAGGATTTTCTTTTTGAAAAAGG - Intergenic
974417864 4:61634159-61634181 CTTTATTTTTATGTTATAAAAGG - Intronic
975758714 4:77596977-77596999 CAGCATTTTCATCTTTTTAAAGG - Intronic
975826770 4:78328606-78328628 CAGTTCATTCATTTTGTAAAAGG + Intronic
976309234 4:83593564-83593586 CAGGATTTTCATTATGAAAATGG - Intronic
976474237 4:85464353-85464375 CAATATTTTTATGTTCTAAGAGG - Intergenic
976919963 4:90426898-90426920 CAGTATTTTCATTGAGAAAATGG - Intronic
978139288 4:105299115-105299137 CAGTTTCTTCATATTGTCAATGG - Intergenic
978548868 4:109902944-109902966 CAAAATCTTCATGTTGTGAATGG + Intergenic
979823757 4:125206891-125206913 CAGTATTTTTCTCATGTAAATGG + Intergenic
979865939 4:125753902-125753924 CAGTATTTTCAAGTTGTTGGAGG + Intergenic
980490115 4:133513813-133513835 CAGTATTTTCATTTTGAGATTGG + Intergenic
980706064 4:136497333-136497355 CAAGATTTTCATGTTGAATAAGG - Intergenic
980767344 4:137323947-137323969 CACCATTTTCATGCTGTAAGAGG + Intergenic
981071935 4:140550421-140550443 CAGAATTTATATGTTGTAATAGG + Exonic
981565352 4:146095801-146095823 TAGTATTTTCACTTTCTAAAGGG + Intergenic
983105451 4:163681131-163681153 CAGTATCTCCATATTTTAAAGGG + Intronic
983194288 4:164788340-164788362 TAGAATTTTCATTTTATAAAAGG + Intergenic
983466241 4:168095710-168095732 TAGTATTTTCATCTGGAAAAAGG - Intronic
983519613 4:168693795-168693817 CAGCATTTTAACGCTGTAAAAGG - Intronic
983841073 4:172457275-172457297 CAGTTTCTTCATGGTGTCAATGG - Intronic
984565197 4:181321348-181321370 CATTATTTTAATTTTTTAAATGG + Intergenic
984609403 4:181820661-181820683 AAATATTTTCATGTTCTAATGGG + Intergenic
985368333 4:189258030-189258052 CAGTATTTTCTTTTTGAGAAGGG + Intergenic
986737008 5:10675348-10675370 CAGTTTCCTCATCTTGTAAATGG + Intergenic
986816008 5:11412268-11412290 AAGTATTAGCATGTTTTAAATGG + Intronic
987039124 5:14045493-14045515 CAGTATTTGTATTTTGTGAATGG - Intergenic
987319883 5:16758728-16758750 CAGTTTTTTCATCTGGAAAATGG + Intronic
987451612 5:18091397-18091419 AGGTATTTTCATATTATAAAAGG + Intergenic
987840392 5:23216416-23216438 TAGTATTTTCATCTTCAAAATGG + Intergenic
988203754 5:28105557-28105579 CCATAGTTTCATGGTGTAAATGG - Intergenic
988349885 5:30088391-30088413 CAGTATTGTCATCTTGAAAAAGG - Intergenic
988833901 5:35013122-35013144 CAGTTACTTCGTGTTGTAAATGG + Intronic
989037325 5:37189193-37189215 CAGTATTTTCATTTTCTTTAGGG + Intronic
989086605 5:37683553-37683575 CAGTATTTGCTTGTTTGAAAAGG + Intronic
989201799 5:38771158-38771180 CAGTATTTTGATATTTTTAATGG - Intergenic
989535442 5:42558277-42558299 CATTATGGTTATGTTGTAAAAGG - Intronic
990649812 5:57885567-57885589 AATTATTTTCATGTTTTAACAGG + Intergenic
991236909 5:64408946-64408968 CAGTTTTTTCATAGTGTCAATGG - Intergenic
991283566 5:64943463-64943485 TTATACTTTCATGTTGTAAATGG - Intronic
991467897 5:66934168-66934190 TAGTATATTCACATTGTAAAGGG - Intronic
991595191 5:68297214-68297236 CTGTATTTTCATCTTTAAAATGG - Intronic
993425763 5:87762491-87762513 CAGGATTTTCAAGTTTCAAATGG + Intergenic
993581269 5:89664259-89664281 CAGTATTTTCCTGTAGTATTTGG - Intergenic
993721696 5:91327370-91327392 CAGTAATTTGATATTGTAATGGG + Intergenic
993990917 5:94657921-94657943 CAGTCTTTACATGTTTTAACAGG + Intronic
994015250 5:94957329-94957351 CAGTTTCTTCATATTGTCAATGG - Intronic
994257325 5:97614467-97614489 CAGTATTTTTATTTTCTGAATGG + Intergenic
994451385 5:99949414-99949436 CAGCATTTTAATGATTTAAAGGG - Intergenic
994728712 5:103466215-103466237 CAGTATTTTCATGTCTTCAAGGG - Intergenic
995662547 5:114501138-114501160 CAGTATTTTCATCTGTAAAATGG - Intergenic
995680325 5:114710699-114710721 CAGTATTTTCATCTATAAAAGGG - Intergenic
995983431 5:118137289-118137311 TTGTCTTTTCATTTTGTAAATGG + Intergenic
996522580 5:124443640-124443662 CAGTATCTTCATGTGTAAAACGG + Intergenic
996606702 5:125331173-125331195 CAGTATTTTCACCTGGAAAAAGG - Intergenic
996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG + Intergenic
997023659 5:130032485-130032507 CACCATTTTCATTTTGGAAATGG - Intronic
997125003 5:131217181-131217203 CATTATTTTCATATTGTCTATGG + Intergenic
998265821 5:140667023-140667045 CTGTATTTTCATCTTTGAAAGGG + Intronic
999301813 5:150495831-150495853 CAGTATTTTCATCTATTAAGTGG - Intronic
999816286 5:155179897-155179919 CACTATTTTCTTGTTGTTACTGG - Intergenic
1000248089 5:159466506-159466528 TAGTATTTTCATGTGTAAAATGG + Intergenic
1001609468 5:172988615-172988637 CAGTATTTTCAAGAGGTAAAGGG - Intronic
1002390468 5:178907766-178907788 CTGTATTTTCATGTTGTAAGTGG - Intronic
1003409028 6:5847155-5847177 CAGGATATTTATGTTGTGAATGG + Intergenic
1003603496 6:7540360-7540382 CTACATTTTTATGTTGTAAAGGG - Intergenic
1003609505 6:7597033-7597055 CCGTATTTTTATTTTTTAAAAGG + Intronic
1003668517 6:8133609-8133631 CTTTATTTTTATGTGGTAAAAGG - Intergenic
1003738521 6:8906591-8906613 TTGTATTTTCATGTTGTAAATGG + Intergenic
1005208316 6:23430843-23430865 CAGTTTCTTCATGGTGTTAATGG + Intergenic
1005654357 6:27918378-27918400 CACTATTTTCTTGTGATAAATGG - Intergenic
1005656302 6:27941765-27941787 TAGAAGTTTCATGCTGTAAATGG + Intergenic
1005827488 6:29643127-29643149 CAGTTTTCCCATTTTGTAAATGG - Intergenic
1005900247 6:30211160-30211182 CAGAATTTTAATGTGGGAAAGGG - Intronic
1007975828 6:46100342-46100364 CAGTTTTTTCATCTTTAAAATGG - Intergenic
1008026056 6:46637085-46637107 CTGCATTCTCATGTGGTAAAAGG - Intronic
1008307110 6:49916948-49916970 CAGTAACTTCATTTTGTAAATGG - Intergenic
1008347591 6:50447386-50447408 CAGTGTTTTCCTGTTTTTAATGG - Intergenic
1008698796 6:54074188-54074210 CAGTATGTTCCTGTTGTGATAGG + Intronic
1008867478 6:56230574-56230596 AAGTATTGTCATGTTTTATAAGG + Intronic
1010058604 6:71594498-71594520 AATTAGTTTCATGTTGTAGATGG + Intergenic
1010936805 6:81871661-81871683 CAGTTTCTTCATGGTGTCAATGG - Intergenic
1011020479 6:82807563-82807585 CAGTTTTTTCATAGTGTCAATGG + Intergenic
1011394827 6:86895283-86895305 TGGTATTTTCCTGTTGTACAAGG - Intergenic
1012871094 6:104673133-104673155 CAGTTTTTTCATAGTGTCAATGG - Intergenic
1012955188 6:105562471-105562493 CAGTATTTTCATTTTGCACTAGG + Intergenic
1013374984 6:109505966-109505988 CTGTATTCTCATGTGGTAGAAGG + Intronic
1013618188 6:111864367-111864389 CAGTTTTTCCATCTTTTAAATGG + Intronic
1014836349 6:126165359-126165381 CAGTATTTTCATAGTGTTGATGG + Intergenic
1014888022 6:126805827-126805849 CTTTTTTTTCATCTTGTAAATGG + Intergenic
1014990705 6:128072323-128072345 CAATATTTTCAACTTGTAATGGG - Intronic
1015329304 6:131958672-131958694 AACTAGTTTCATGTTGTTAATGG + Intergenic
1015646876 6:135401430-135401452 CAGTATTTTTATATTGTTGAAGG - Intronic
1016273846 6:142324652-142324674 TAGTATTTTAATGGTGGAAATGG + Intronic
1016761461 6:147742011-147742033 CAGTCTTTGCATGTTGAATATGG - Intergenic
1018945248 6:168343435-168343457 CAGTATGTTAAGGTTGAAAAGGG - Intergenic
1020635109 7:10686983-10687005 CAATATTTTCCTGTTGGAGAAGG - Intergenic
1020718109 7:11704261-11704283 CAGCATTTTCATATTGAATAGGG + Intronic
1020722839 7:11770398-11770420 CTGTAATTTCATGTACTAAATGG - Intronic
1020723962 7:11785472-11785494 CAGCATTTCCATTTTGTAAAGGG + Intronic
1020769725 7:12374031-12374053 CATTTTTTTCATGATGCAAATGG - Intronic
1020986446 7:15141087-15141109 AAGAACTTTCATCTTGTAAATGG + Intergenic
1021062167 7:16126960-16126982 CATTATTTTCATTGTATAAATGG - Intronic
1021498870 7:21307351-21307373 CAGTTTTCTCATGTTTAAAATGG - Intergenic
1021609922 7:22446791-22446813 CAGTATTTTCATCTGTGAAATGG + Intronic
1021961439 7:25877061-25877083 CAGTATTTTCATCTATGAAATGG + Intergenic
1022120959 7:27307619-27307641 CAGTAGTTTCATTTTGCAGATGG + Intergenic
1022434824 7:30372922-30372944 CACAATTTTCATGATGTAAAAGG + Intronic
1026488371 7:70840236-70840258 CAGTTTCTTCATGGTGTCAATGG - Intergenic
1027305734 7:76894501-76894523 CAGGGTTTTCATCTGGTAAATGG - Intergenic
1028664345 7:93323440-93323462 CAGTAGTTTCATGTGGCTAATGG - Intronic
1029788675 7:102819608-102819630 CATTGTTTTCATGTTCAAAATGG + Intronic
1029918948 7:104241632-104241654 CAGGATTTTTTTGTTGCAAAGGG - Intergenic
1030010987 7:105167320-105167342 AAATATTTTCATTTTTTAAAAGG + Intronic
1031466777 7:122122846-122122868 CAGTATGTTCACGTTTTAAATGG - Intronic
1031502109 7:122531602-122531624 CAGTTTTTTCTAATTGTAAATGG + Intronic
1031618497 7:123907989-123908011 CATTCCTTTCATGTTGTGAAGGG - Intergenic
1031745637 7:125494375-125494397 CAGAATTTTCTTCTTTTAAAAGG - Intergenic
1032211862 7:129922631-129922653 CAGTATTTGCAAATTATAAATGG + Intronic
1032603842 7:133328502-133328524 CAGTTTTTTCATAGTGTCAATGG + Intronic
1032893521 7:136224527-136224549 CAGTTTTTTCATAGTGTCAATGG - Intergenic
1033523733 7:142188890-142188912 CAGTATTTTCAACTTGTGATGGG + Intronic
1033669717 7:143479305-143479327 AAGTATCTTCATGCAGTAAAGGG - Intergenic
1035901782 8:3464812-3464834 CAGTATTTTCATTTGTAAAATGG + Intronic
1036296334 8:7541142-7541164 TTGTATTTTAAAGTTGTAAAGGG + Intronic
1036326232 8:7779877-7779899 TTGTATTTTAAAGTTGTAAAGGG - Intronic
1037258065 8:16977918-16977940 CAGTTTCTTCATAGTGTAAATGG + Intergenic
1037291423 8:17353181-17353203 CAGTATTTTCTTTTTGTGACAGG - Intronic
1037744053 8:21629328-21629350 CAGTTTTTCCATGTGCTAAACGG - Intergenic
1038125747 8:24670939-24670961 CAGTATTTTCATTTGTTAATTGG - Intergenic
1038131347 8:24735087-24735109 CAGTATTTTCATATTACATAGGG + Intergenic
1038224134 8:25639551-25639573 GACTCTTTTCATGTTGCAAAAGG + Intergenic
1038968119 8:32598933-32598955 CAGGATATTAATGTTTTAAATGG - Intronic
1039284764 8:36028413-36028435 CAGTTTTTTCATTGTGTGAATGG - Intergenic
1039987843 8:42463004-42463026 CAGAATTTTCATCTTAAAAAAGG - Exonic
1040624631 8:49133115-49133137 TACTTTTTTCATGTGGTAAAAGG + Intergenic
1041155274 8:54978949-54978971 CAGTTTTTTCATACTGTGAATGG - Intergenic
1041317485 8:56579576-56579598 CATTATTACCATGTTGTAATGGG + Intergenic
1042464957 8:69118288-69118310 AAGTGTATTCATGTTGGAAAAGG + Intergenic
1042701823 8:71623954-71623976 CAGTATCTCCATTTTGCAAATGG + Intergenic
1043167889 8:76927014-76927036 CAGTTTTTTCATCTTTAAAATGG + Intergenic
1043269923 8:78319564-78319586 CTGTTTTTTCATGTTATATATGG - Intergenic
1043374534 8:79633610-79633632 CTGCATTTTCATGTGGCAAAAGG + Intronic
1043399446 8:79869281-79869303 AACAATTTTCATGTTGTCAATGG - Intergenic
1043530027 8:81139498-81139520 CAGGATTTTCCTAATGTAAATGG + Intergenic
1043754205 8:83982298-83982320 TAGTATTTTCATGTTTTGGATGG - Intergenic
1044323087 8:90827698-90827720 GAGTATTTTCATGAGATAAAAGG - Intronic
1044483820 8:92725708-92725730 CAGTATATTCATGTTTGAGACGG + Intergenic
1045184952 8:99828676-99828698 CAGTTTTTTCATAGTGTTAATGG + Intronic
1045656996 8:104397716-104397738 CAGCATTATCATCTTGGAAATGG - Intronic
1045756461 8:105549181-105549203 CTCTATATTCATGTTGGAAAGGG + Intronic
1045760047 8:105594602-105594624 CAGTTTTCTCATGTGTTAAATGG - Intronic
1046630939 8:116622549-116622571 GCTTATTTTCAGGTTGTAAATGG - Intergenic
1046727591 8:117691883-117691905 CAGCATTTTCATTTTGAAAAGGG + Intergenic
1047102275 8:121690628-121690650 TAGTGTTTTCATGTTGTGATCGG - Intergenic
1047397913 8:124519550-124519572 CAGTAGTTTCTTATTTTAAAAGG + Intronic
1047801799 8:128317887-128317909 CAGTTTTTTTATCTAGTAAATGG + Intergenic
1047838723 8:128723275-128723297 TGGTTTTTTCATGATGTAAATGG + Intergenic
1047923967 8:129664603-129664625 CTGTCTTTTCATCTTGAAAAAGG - Intergenic
1048054946 8:130854591-130854613 CAGTATTTTCATCTGTTGAAAGG - Intronic
1048572894 8:135669726-135669748 CAGTAGTCTCATGTGGAAAATGG + Intergenic
1048637608 8:136315019-136315041 CATTATTTTCATGTTGTTTAGGG + Intergenic
1049368211 8:142251087-142251109 CAGCATTTTCGTCTTTTAAATGG - Intronic
1049972948 9:837470-837492 CTGTATTTTCATTTTCTTAATGG + Intergenic
1050043775 9:1522534-1522556 CATTGTTTTCCTTTTGTAAAGGG + Intergenic
1050285777 9:4100367-4100389 GAGTATTTGTATGTTTTAAATGG + Intronic
1051087864 9:13371874-13371896 CAGTATTTTCTTGTTCTTAGTGG + Intergenic
1051567053 9:18512089-18512111 TAGTCTTTTCATTTTGTTAAAGG + Intronic
1052256869 9:26467314-26467336 CAGTTTTTTCATCTGGAAAATGG - Intergenic
1052365988 9:27613020-27613042 CAGTTTTTTCATAGTGTCAATGG + Intergenic
1052968176 9:34358317-34358339 CAGTATTTCCTTCTTTTAAATGG + Intergenic
1053332281 9:37224112-37224134 CAGTATATTAATTTTTTAAAAGG + Intronic
1053365891 9:37522244-37522266 CAGTTTTCTCATCTTTTAAATGG + Intronic
1055034156 9:71800059-71800081 CACTATTGTCCTGTTGTATAAGG - Intronic
1055793373 9:79947495-79947517 CTGTTTTTACATGTTGTATAGGG + Intergenic
1056046069 9:82717846-82717868 CAGTGGTTCCATGGTGTAAATGG - Intergenic
1056838049 9:89973834-89973856 CAGAATTTCCATGTTTTTAAAGG + Intergenic
1057170747 9:92961564-92961586 TAGTATTTTCATCATGAAAAAGG - Intronic
1057579702 9:96275863-96275885 TACTATTGTCATTTTGTAAATGG - Intronic
1057666846 9:97052670-97052692 CACTATTTACATGTTGGGAATGG + Intergenic
1057945954 9:99328439-99328461 TAGTATTGTCATATAGTAAATGG + Intergenic
1058178831 9:101771101-101771123 CAATACTTTTATGTTTTAAAAGG - Intergenic
1058523155 9:105831973-105831995 CAGTTTTAAAATGTTGTAAAGGG - Intergenic
1059163337 9:112055898-112055920 CAGTATTTTCTTTTTGTGACTGG - Intronic
1059440406 9:114303611-114303633 CAGTTCTTTCATCTTGAAAATGG - Intronic
1059646631 9:116274612-116274634 CAGTGTTCTCATGTAGAAAATGG + Intronic
1060039498 9:120287588-120287610 CTGTATTTTCATGTTGCACTGGG - Intergenic
1060367075 9:123027844-123027866 CACTATTTTCATGTAGGACAAGG - Intronic
1060581499 9:124751072-124751094 CATTATTTTCATTTTGCAGATGG - Intronic
1062033722 9:134373450-134373472 CAGTATTCTCATCTGGAAAATGG - Intronic
1203489815 Un_GL000224v1:93978-94000 TTTTATTTTCATGATGTAAAAGG + Intergenic
1203502438 Un_KI270741v1:35864-35886 TTTTATTTTCATGATGTAAAAGG + Intergenic
1203713623 Un_KI270742v1:122169-122191 CAGTTTTTTCATTGTGTCAATGG + Intergenic
1186853816 X:13606862-13606884 CAGTATTTATATTTGGTAAAAGG + Intronic
1187777823 X:22783524-22783546 CATTTTGTTCATGTTTTAAAAGG - Intergenic
1187854905 X:23627559-23627581 AAGTATTTTTCTTTTGTAAATGG - Intergenic
1187946265 X:24428813-24428835 CAGTATTTTCAACTTGCAATAGG - Intergenic
1188151771 X:26685354-26685376 AAGTATTTCCATGTTGTAAATGG - Intergenic
1188350266 X:29121441-29121463 CAGCCTTATCATGTTGCAAAAGG - Intronic
1189595396 X:42559626-42559648 GACTATTTTCAGCTTGTAAAGGG + Intergenic
1189822724 X:44886039-44886061 CAGTATTTTCATATAGCAAGAGG - Intronic
1191165914 X:57392048-57392070 TAGTATTTTATTTTTGTAAATGG + Intronic
1192889179 X:75370210-75370232 GAGTATCTTCATTTTGCAAACGG + Exonic
1192897780 X:75461709-75461731 CAGTATTTTCTTGTCTGAAAAGG - Intronic
1193378539 X:80790414-80790436 ATGTATTTTCATGTAGTAACTGG - Intronic
1193652436 X:84154089-84154111 CAGTATTTTAAAGGTGGAAACGG - Intronic
1193758613 X:85439016-85439038 CAGTATTTGCTTGTTTTAAAAGG + Intergenic
1194196918 X:90905398-90905420 TAGTATTTCCATTTTATAAATGG - Intergenic
1194446135 X:93988826-93988848 CAGTTTTTTCATGGTGTCATTGG - Intergenic
1194793381 X:98179141-98179163 AAGTATTTTCATTTGTTAAATGG + Intergenic
1196171103 X:112589494-112589516 CAATATTTTCCTGTTGGACAAGG - Intergenic
1196592039 X:117496724-117496746 CAGTATTTGCTTGTTTGAAAAGG - Intergenic
1197621222 X:128751962-128751984 CAGTAATTTAATGGTGGAAATGG - Intergenic
1197626856 X:128811808-128811830 TATTATTTTCATTTTGTATATGG - Intergenic
1197828216 X:130613438-130613460 CAGTTTTTTCATGTGTAAAATGG - Intergenic
1198304014 X:135362523-135362545 GAATATTTTCATGTTTTAACAGG - Exonic
1198488817 X:137117162-137117184 CAGTTTCTTCATGTTTAAAATGG - Intergenic
1198525145 X:137493162-137493184 CAGTTTTTCCATGTAGAAAAGGG - Intergenic
1198616717 X:138465589-138465611 TGATATTTTCCTGTTGTAAAAGG - Intergenic
1198712675 X:139522986-139523008 CGATATTTTCATGTTGGACAAGG - Intergenic
1199088752 X:143665872-143665894 CAGAATTTCCATGTTCCAAAAGG + Intergenic
1199436826 X:147821453-147821475 CAGTTTTTTCATAGTGTTAATGG - Intergenic
1199462051 X:148095657-148095679 CAGTAATGACAAGTTGTAAAAGG + Intergenic
1199568356 X:149242106-149242128 CAGGATTTTCTTCTTTTAAAAGG - Intergenic
1200420381 Y:2958934-2958956 AAGTACTTTCAGGTTGTTAATGG + Intronic
1200877166 Y:8169824-8169846 CAGTAATATAATGTTGTAAATGG - Intergenic
1201056511 Y:9997932-9997954 CAGCAATATAATGTTGTAAATGG + Intergenic
1201167867 Y:11227311-11227333 CAGTTTTTTCATAGTGTCAATGG + Intergenic
1201478981 Y:14416847-14416869 AAATATTTTCATGTTGTCACTGG - Intergenic
1201688881 Y:16739881-16739903 GAATATTTTCATGTTGGAAATGG - Intergenic
1202104169 Y:21344925-21344947 CAGCAATATAATGTTGTAAATGG - Intergenic