ID: 912415978

View in Genome Browser
Species Human (GRCh38)
Location 1:109508844-109508866
Sequence CTCAAAAAGCAGCAGGGACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912415973_912415978 -9 Left 912415973 1:109508830-109508852 CCAGCTCTGGCCACCTCAAAAAG 0: 1
1: 0
2: 0
3: 21
4: 267
Right 912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG 0: 1
1: 0
2: 2
3: 37
4: 503
912415972_912415978 2 Left 912415972 1:109508819-109508841 CCACGGCTCGGCCAGCTCTGGCC 0: 1
1: 0
2: 1
3: 21
4: 243
Right 912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG 0: 1
1: 0
2: 2
3: 37
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912415978 Original CRISPR CTCAAAAAGCAGCAGGGACA AGG Exonic
900892424 1:5458944-5458966 CTCTTAAAGAAGCAGGGAAATGG + Intergenic
901302926 1:8212705-8212727 CTCAAGAGGCTGCAGGGTCATGG + Intergenic
902608583 1:17583317-17583339 CTCACCCAGCAGCAGGGACTGGG + Intronic
904323231 1:29710111-29710133 CTCAGACAGCAGGAGGGCCATGG - Intergenic
904382781 1:30122827-30122849 TTCAAGAAGCAGCAGAGCCATGG - Intergenic
904432159 1:30471292-30471314 GGTAAAAAGGAGCAGGGACAGGG - Intergenic
904489687 1:30850699-30850721 TTAAAACAGCAGCAGGCACATGG - Intergenic
905241566 1:36584747-36584769 CGCAAAAAGCTGCATGGAGAAGG - Intergenic
906105617 1:43290366-43290388 CTATAAAAGGAGCAGAGACATGG + Intergenic
906580286 1:46930238-46930260 CTCAAAGCGGAGCAGGGTCAGGG + Exonic
906584943 1:46967797-46967819 CTCAAAGCGGAGCAGGGTCAGGG + Intergenic
906603440 1:47148652-47148674 CTCAAAGCGGAGCAGGGTCAGGG - Exonic
906766425 1:48438751-48438773 CTAGAAAAGCACCAGAGACAGGG - Intronic
907100236 1:51825997-51826019 CTCATACAGCAGAAGGGGCAAGG - Intronic
907446293 1:54510080-54510102 ATAAAAAAGCAGCAGGAACTGGG + Intergenic
907672984 1:56493011-56493033 TTCAAAATCCAGCAGGGACCAGG - Intergenic
907793587 1:57692263-57692285 CTAGAAAAGCACCAGAGACAGGG - Intronic
907842112 1:58168494-58168516 CTAGAAAAGCACCAGAGACAGGG - Intronic
908027396 1:59967442-59967464 TACCACAAGCAGCAGGGACAGGG + Intergenic
908038506 1:60082184-60082206 TTCCAAGAGCAGCAGGGAGATGG - Intergenic
908660098 1:66425930-66425952 CTAGAAGAGCACCAGGGACAGGG + Intergenic
909497765 1:76298480-76298502 GTTCTAAAGCAGCAGGGACAAGG + Intronic
909692210 1:78421375-78421397 TTAAAAAAGCAGCAGGGGCTGGG - Intronic
909721570 1:78777112-78777134 CTCAAAAAGCAGCAGAAAAGGGG - Intergenic
910270294 1:85386962-85386984 AGCTAAAAGCAGCAGGGACTGGG + Intronic
911130010 1:94377846-94377868 CTAGAAAAGCACCAGAGACAGGG + Intergenic
911161258 1:94685015-94685037 CACAAAAGGCAGCAGCTACAGGG - Intergenic
911683676 1:100748451-100748473 CTTAAAAAGCAGCAGACTCAAGG + Intergenic
911845841 1:102749125-102749147 CTAAAAAAGCACCAGAGGCAGGG + Intergenic
912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG + Exonic
912790967 1:112650312-112650334 CCAAAAAAGCAGCATGGACAGGG - Intronic
913225121 1:116692295-116692317 GGCGAAGAGCAGCAGGGACATGG - Intergenic
913382410 1:118226572-118226594 CTAGAAAAGCACCAGAGACAGGG - Intergenic
913586061 1:120277010-120277032 CTCAGAAAGAGGCAGGGTCAAGG - Intergenic
913622124 1:120621359-120621381 CTCAGAAAGAGGCAGGGTCAAGG + Intergenic
914568070 1:148888868-148888890 CTCAGAAAGAGGCAGGGTCAAGG - Intronic
914604754 1:149241380-149241402 CTCAGAAAGAGGCAGGGTCAAGG + Intergenic
914804316 1:150981623-150981645 CCCAAAAGGCAACAGGGAGATGG - Intergenic
914886999 1:151593764-151593786 TTCAAAAAGCGGCAGAGAGATGG + Intergenic
915570608 1:156743399-156743421 CCCAGACAGCAGCAGGAACAGGG + Exonic
916114225 1:161473714-161473736 CTAGAAAAGCACCAGAGACAGGG - Intergenic
916308514 1:163367549-163367571 CTGGAACAGCAGCAGGAACATGG - Intergenic
917227338 1:172799290-172799312 CTAGAAAAGCACCAGAGACAGGG - Intergenic
917530579 1:175831429-175831451 TTCAAAAAGCTTCAGGGACCTGG + Intergenic
918750380 1:188262669-188262691 CTAGAAAAGCAACAGAGACAGGG + Intergenic
919125598 1:193389010-193389032 GTCAAAAAGGAGTAGTGACAGGG + Intergenic
923934796 1:238748358-238748380 CTCATAAAGTATCAGGGAAAGGG + Intergenic
924120081 1:240788793-240788815 CTCAAAAATCACCAGGGGCTTGG - Intronic
1062792846 10:320803-320825 CTCACAGAGCAGAAGCGACATGG + Intronic
1063859304 10:10290669-10290691 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1064603779 10:17017788-17017810 CTAGAAAAGCAACAGAGACAGGG + Intronic
1065842168 10:29711438-29711460 AACAAAAAGCAGGAGAGACATGG + Intronic
1065900018 10:30198014-30198036 CTCTCATAGCAGCAGGGAGAAGG - Intergenic
1065943034 10:30582313-30582335 CTCAAGAAACAGCAGCAACAAGG + Intergenic
1066950449 10:42111837-42111859 CGCAAAAAGCAGCAGCGGCAGGG + Intergenic
1066950540 10:42112265-42112287 TGCAAAAAGCAGCAGCGGCAGGG + Intergenic
1067060553 10:43076078-43076100 CTCAAAAAGCAGCCGGGGATGGG + Intergenic
1067705524 10:48604232-48604254 CTCAGAAAGCTGCAGGGTCTGGG - Intronic
1067804486 10:49383491-49383513 GTCACAAAACAGCAGGGCCATGG + Intronic
1068240435 10:54296531-54296553 CTAGAAAAGCACCAGAGACAGGG - Intronic
1068500099 10:57833659-57833681 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1069137550 10:64783831-64783853 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1069234775 10:66057128-66057150 CTCAAAAACAGGCAGGGAAAAGG - Intronic
1069365297 10:67689453-67689475 CTAGAAAAGCACCAGAGACAGGG + Intronic
1069559613 10:69420209-69420231 CTCAAACAGCAGGAAGGGCATGG - Intergenic
1070520954 10:77253177-77253199 CTCAAAAAGCTGCAAAGAGAAGG + Intronic
1071220929 10:83463859-83463881 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1071483399 10:86081223-86081245 CTCAAAGAGGAGCAGAGAAATGG + Intronic
1071834633 10:89407342-89407364 CTAGAAAAGCACCAGAGACAGGG - Intronic
1072260732 10:93669156-93669178 CTCAAAAAGCAGCTGGAAATAGG + Exonic
1072731851 10:97851562-97851584 CTCACAAAGCACCAAAGACATGG + Intronic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073704558 10:105968428-105968450 CTCAGAATGCGGCTGGGACAGGG + Intergenic
1073970538 10:109042251-109042273 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1073996225 10:109318067-109318089 GTCACACAGCAGCAGGGACCTGG + Intergenic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1074612800 10:115038021-115038043 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1074742845 10:116501363-116501385 CTACAAAAGCACCAGAGACAGGG + Intergenic
1075173129 10:120134373-120134395 CTGAACATGCAGCAGGGGCATGG + Intergenic
1076534914 10:131170759-131170781 CTCAAAGGGCCGCAGGGACTGGG + Intronic
1076742306 10:132492624-132492646 TTCAAAGAGCAGGGGGGACAAGG - Intergenic
1077117312 11:891024-891046 CTGCAAAAGCACCAGGGACAGGG + Intronic
1077488401 11:2849575-2849597 CACAGAAAGCTGCAGGAACAGGG - Intergenic
1078443168 11:11384415-11384437 CTCAAGTGGCAGCAGGGAGAAGG + Intronic
1078821966 11:14891847-14891869 CTCAAAGGGCAGCCGGCACACGG + Intronic
1079485822 11:20935159-20935181 TGCAATTAGCAGCAGGGACATGG + Intronic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1081033211 11:38112459-38112481 CTAGAAAAGCACCAGAGACAAGG - Intergenic
1081145802 11:39561746-39561768 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1081305540 11:41507800-41507822 CTGAAAGAGCAGCAGGTACCTGG + Intergenic
1081813786 11:45927667-45927689 CCCAGAAAGGAGCAGGGACATGG - Intronic
1083141725 11:60727557-60727579 CTCAGGATGCAGCTGGGACAGGG + Intergenic
1083159859 11:60848283-60848305 CTGAAAGAGCCTCAGGGACAGGG + Intronic
1083197747 11:61099150-61099172 CTCTAAGAGCAACAGGGACACGG + Intergenic
1083315761 11:61814233-61814255 CTCAAAAGGCAGCTGGGCCTAGG - Intronic
1084178455 11:67435202-67435224 CTCTCACAGCCGCAGGGACAGGG - Exonic
1084938970 11:72602241-72602263 CCCAAACAGCGGCAGGAACAGGG + Intronic
1085170609 11:74446658-74446680 CTCACAAGTCAGCTGGGACAGGG + Intergenic
1086014448 11:82149695-82149717 GTCATAGAGAAGCAGGGACAAGG + Intergenic
1086783731 11:90938823-90938845 CTCAAAAAGCAGGAGAGTGAAGG + Intergenic
1086802025 11:91187634-91187656 TTAAAAAAGAAGCAGGGAAAAGG - Intergenic
1087319065 11:96637445-96637467 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1087497568 11:98909988-98910010 CACACAAAGCAGCAGGGCCCTGG - Intergenic
1087874905 11:103343373-103343395 CTAGAAAAGCACCAGAGACAGGG - Intronic
1088366397 11:109044691-109044713 CTCAAAAAGCAACAGAGCCTAGG + Intergenic
1088492343 11:110400444-110400466 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1088752770 11:112858649-112858671 CCCAGACAGCATCAGGGACATGG + Intergenic
1089330597 11:117686399-117686421 CTCAGAAAGAAGCAGGCACTGGG + Intronic
1091090994 11:132771179-132771201 TTCAAAAAGCACCAGGGTCTTGG + Intronic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1091249285 11:134128658-134128680 TTCACAAAGCAGCAGGGGAAAGG - Intronic
1091264352 11:134258975-134258997 ATCAAAAGGCAGCAGAGAGAAGG - Intronic
1094320181 12:29174387-29174409 CTGGAAAAGCACCAGAGACAGGG + Intronic
1095662856 12:44757936-44757958 TTGAAAAAGCAGAAGGGATATGG + Intronic
1096154045 12:49331999-49332021 CTCAAAAAGCAAGGGGAACAGGG - Intergenic
1096748728 12:53745349-53745371 CTCAAAAACCAGAGTGGACAAGG + Intergenic
1099414953 12:82373488-82373510 CTAGAAAAGCATCAGAGACAGGG + Intronic
1099577080 12:84394644-84394666 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1099580447 12:84440067-84440089 CTCAAAATCCAGAAGGGAAAGGG - Intergenic
1099833094 12:87870737-87870759 CTCAAATATCTGCAGGGACTAGG - Intergenic
1100126112 12:91427647-91427669 CTCACAAAGCAGGAGTGAAAAGG + Intergenic
1100134440 12:91537993-91538015 CACATAGAGGAGCAGGGACATGG - Intergenic
1100530512 12:95457317-95457339 CTAGAAGAGCACCAGGGACAGGG + Intergenic
1101390758 12:104297872-104297894 CTCAAAAGGCAGCAATGACTAGG - Intronic
1101547793 12:105732963-105732985 CTCAACAACAAGCAGGGACAAGG - Intergenic
1101704672 12:107210900-107210922 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1102561414 12:113764931-113764953 CTCACTCAGCTGCAGGGACAGGG - Intergenic
1102734838 12:115150245-115150267 CTCAAACAGCAGAAGGGGCAAGG + Intergenic
1102929057 12:116848790-116848812 AACAAAAAGCAGGAGGGAGAAGG - Intronic
1103197278 12:119055735-119055757 CTCGAACAGCAGCAGGACCATGG + Intronic
1103826348 12:123742201-123742223 CACAAAAAGCAGCTGGAACTGGG - Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104305975 12:127611281-127611303 CTAGAAGAGCACCAGGGACAGGG - Intergenic
1104321367 12:127754466-127754488 CTCAAAAAGCACAGGGTACAAGG - Intergenic
1104528191 12:129544255-129544277 CTAAGAAAGCAACAGGGAAATGG - Intronic
1105440189 13:20408465-20408487 CCCAAACAGCCCCAGGGACAAGG + Intronic
1105637777 13:22232053-22232075 ATCAAAAAGCAGATGGGAAAAGG - Intergenic
1106074256 13:26443852-26443874 ATCAAAAGGCAACAGGGGCAGGG - Intergenic
1106162478 13:27213660-27213682 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1106180053 13:27362547-27362569 CCCAAACAGCAGCGGCGACAGGG - Intergenic
1106240711 13:27910757-27910779 CCTAAAAAGCAGCAGGGAGTGGG - Intergenic
1106964850 13:35050934-35050956 CTCAAATAATAGCAGAGACAAGG + Intronic
1107307262 13:39036617-39036639 CTCAAAAAGCAGCAAAAACTTGG + Intronic
1108222792 13:48254371-48254393 CTGGAAAAGAAGCAGAGACATGG - Intronic
1108848405 13:54701354-54701376 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1110557457 13:76876625-76876647 CCCAAAAAGCAGAATGGAGAAGG + Intergenic
1111372344 13:87334627-87334649 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1112039717 13:95534894-95534916 CTCACAGCTCAGCAGGGACATGG + Intronic
1112195688 13:97224113-97224135 GGCAAAAAGCAGCAGGGAGCAGG + Intronic
1112516332 13:100056183-100056205 CTCAACAAACAGCAGATACAAGG - Intergenic
1112693834 13:101925883-101925905 AACAAAAAGCAGCAGGGAAATGG - Intronic
1112796836 13:103066302-103066324 CTCAACCAGCAGCAGAGCCAGGG - Exonic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1115285673 14:31710972-31710994 CTAGAAAAGCACCAGAGACAGGG + Intronic
1118105944 14:62659754-62659776 TTCCCAAAGCAGAAGGGACACGG - Intergenic
1118495602 14:66305382-66305404 CTGAAGAAGCAGCAAGGCCAAGG - Intergenic
1119866997 14:77982185-77982207 CTCAAAAAAAAGCAGGGATGGGG - Intergenic
1120115832 14:80616611-80616633 CGCAAATAGCAGAAGGGTCACGG + Intronic
1120198586 14:81514049-81514071 CTAGAAAAGCACCAGAGACAGGG - Intronic
1120256936 14:82132496-82132518 CAGAAAAAACAGGAGGGACAAGG - Intergenic
1122207390 14:100154823-100154845 CTCCAAGAGTAGCAGAGACAGGG + Intronic
1122470483 14:101962767-101962789 CTCAGAAACCTGCAGGGACCTGG - Intergenic
1122639624 14:103150905-103150927 CTCAAGAAGGACCAGAGACACGG - Intergenic
1122680803 14:103461037-103461059 CAGAATAAGCAGCAAGGACAAGG - Intronic
1122862503 14:104588857-104588879 TTCACCAAGCAGCAGGGCCAGGG - Exonic
1123186201 14:106519100-106519122 CTCCCAGAGCAGCAGGGTCAGGG + Intergenic
1125782163 15:42279364-42279386 CTCAAAATGCAGGTGGGCCAGGG + Intronic
1126072260 15:44875400-44875422 CTTGAAAAGCACCAGGGACAGGG + Intergenic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1127641019 15:60915971-60915993 TTCATAAAACAGCAGAGACATGG + Intronic
1128300456 15:66563700-66563722 TTCAAAAAGCAACAGGGCCCAGG - Intronic
1128513938 15:68330502-68330524 CTCAAAAAGCAGCAAACATACGG + Intronic
1131401917 15:92131951-92131973 CTCATTAAGCTGCAGGGACAGGG + Intronic
1132726634 16:1341733-1341755 GTCCAGAAGCAGCAGGGACCAGG - Intronic
1133411411 16:5572308-5572330 CTAGAAAAGCATCAGGAACATGG - Intergenic
1133898346 16:9950173-9950195 CTCTGACAGCAGCAAGGACATGG - Intronic
1134640695 16:15827364-15827386 CTCAAGACAAAGCAGGGACATGG + Intronic
1135339883 16:21636410-21636432 CTGGAAAAGCACCAGAGACAGGG + Intronic
1135993020 16:27228948-27228970 CTCAGAGAGCAGCAGGAGCAGGG - Intronic
1137218900 16:46427807-46427829 TGCAAAAAGCAGCAGGAACAGGG + Intergenic
1138246065 16:55468068-55468090 CTCAAACAGCAGCAGGAATGTGG + Intronic
1138315479 16:56066035-56066057 CCCTAAAAGCAGCAGGAGCATGG + Intergenic
1138909681 16:61381128-61381150 CTCAAATAGCTGAAAGGACACGG + Intergenic
1140954138 16:79846880-79846902 CCCAAATAGCAGCAGTGCCAAGG + Intergenic
1141140464 16:81493809-81493831 CTCACACAGCAGCCGGGACCGGG + Intronic
1142361799 16:89630903-89630925 CCCACAAAGCAGCAGGGGCCAGG - Intronic
1143975048 17:10823437-10823459 CTCACAATGCAGAAGGAACAAGG + Exonic
1144307644 17:13983710-13983732 CTAAGAAAGCTGCAGGAACAAGG + Intergenic
1145253867 17:21312125-21312147 CTCAATCTGCAGCGGGGACAGGG - Exonic
1145322723 17:21775834-21775856 CTCAATCTGCAGCAGGGACAGGG + Intergenic
1146086547 17:29835758-29835780 CCCAGGAGGCAGCAGGGACAAGG - Intronic
1146310294 17:31763356-31763378 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1147305447 17:39561025-39561047 AACAAAAAGCAGCAGTGTCATGG + Intronic
1149411911 17:56417429-56417451 CTTGAGAAACAGCAGGGACAAGG - Intronic
1149883671 17:60318435-60318457 GTTAAGAAGCAGCAGGGAAAAGG + Intronic
1150229341 17:63541587-63541609 CTCAAAAAGCAACAGGCAGCAGG - Intronic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1150601798 17:66657473-66657495 CTGAACACCCAGCAGGGACATGG + Intronic
1150892652 17:69171432-69171454 CCCAGAAGGCAGCAAGGACAAGG + Intronic
1151170541 17:72242092-72242114 CTGAAATAGCAGCAGGGATGGGG - Intergenic
1152390601 17:80001726-80001748 CTCCAGCAGCAGCAGGGACCAGG - Intronic
1152850052 17:82628286-82628308 CTTAAAAAGGAGCAGGGGCTGGG - Intronic
1153437841 18:5086418-5086440 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1153595791 18:6724136-6724158 CTTAAACAGAACCAGGGACATGG + Intergenic
1153859461 18:9186644-9186666 CTTAAAAAGGAGCAGCAACATGG - Intronic
1153945722 18:10015631-10015653 CTCAGAGGGCAGCAGAGACATGG - Intergenic
1154276758 18:12968391-12968413 CTCCAAAACCAACAGGGAAAGGG - Intronic
1154424355 18:14260689-14260711 TGCAAACAGCAGCAGGGTCATGG - Intergenic
1155476958 18:26244747-26244769 CTAGAAGAGCAACAGGGACAGGG + Intronic
1156146355 18:34185363-34185385 CTCACAAAGCAACAGGAAGAAGG + Intronic
1156409001 18:36810124-36810146 AGCAAAAAGCAGCAGAGTCAGGG - Intronic
1157170313 18:45398396-45398418 ATCAGAAAGCAGCAGGGATTGGG + Intronic
1159402831 18:67959633-67959655 TACAAAAATCAGCAGGGATATGG + Intergenic
1159910082 18:74137888-74137910 CACAATATGAAGCAGGGACAAGG - Intronic
1160354524 18:78215856-78215878 CTAAGAAGGAAGCAGGGACATGG + Intergenic
1161598426 19:5164885-5164907 CTAGAAAAGCACCAGAGACAGGG + Intronic
1161728352 19:5943945-5943967 TTCAAGAGGCAGCAGGGACCAGG - Intronic
1162050300 19:8028747-8028769 CTTCAGAGGCAGCAGGGACAAGG + Intronic
1162107703 19:8380430-8380452 CTAGAAAAGCACCAGAGACAGGG - Intronic
1162420776 19:10565164-10565186 GTCAAACAGCAGGAGGGAGAGGG + Intronic
1164651734 19:29895609-29895631 CTTAAAAATCAGAGGGGACACGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1164943318 19:32268600-32268622 CTACAAAGGCAACAGGGACAGGG + Intergenic
1165678237 19:37747008-37747030 CTCAAAAAACAGAAGGATCAGGG + Intronic
1166096115 19:40540380-40540402 ATTAAAAAGCAGCATGGAGAGGG - Intronic
1168351669 19:55679629-55679651 CTCAAAGATCAGCAAGGACAGGG - Intronic
925038477 2:710690-710712 CTCACACAGCAGAAGGGACAGGG - Intergenic
925179277 2:1806473-1806495 ACCAGAAAGCAGCCGGGACACGG - Intronic
925519100 2:4721212-4721234 GGCAAAAAGCAGCAAGGATATGG - Intergenic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
928318225 2:30262574-30262596 AGCAAAAAGCAGCAGAGAGAAGG - Intronic
929718653 2:44341961-44341983 CTCAACAATCATCAGGAACAAGG + Intronic
929793971 2:45044301-45044323 CACAAAAAGCAGCAGAAACATGG - Intergenic
929968344 2:46552259-46552281 CTCAAAAAGGAGCAGGCCCGAGG + Intronic
930011235 2:46940272-46940294 CTCAAAAGACAGCAGGGTCAGGG - Intronic
930306608 2:49682636-49682658 CCCGAAAAGGAGCAGGGAAATGG - Intergenic
930392053 2:50773695-50773717 CTCAAAATCCAGTTGGGACAGGG + Intronic
930732796 2:54744499-54744521 ATAAAAAAGTAGCATGGACAGGG + Intronic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
931540256 2:63323283-63323305 CTAGAAAAGCACCAGAGACAGGG - Intronic
932344189 2:70985044-70985066 CTCAAAAGGCAGCCGCGGCACGG - Exonic
932507440 2:72249258-72249280 CTCAAAAAATAAAAGGGACAAGG - Intronic
932843037 2:75102044-75102066 CTCAAAAAGCATTAGTGCCATGG + Intronic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
934033482 2:88068071-88068093 CTCAAAAATCATCAGGGGAAGGG + Intronic
934331379 2:92073151-92073173 CCCAAAAAGCAGCAGCGGCGGGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934979208 2:98826394-98826416 CTGAAAATGCAGCCAGGACAGGG + Intronic
935134273 2:100285726-100285748 CTCTACAAGCTGCAGAGACAAGG + Intronic
935939797 2:108226268-108226290 TTCAAAAAGCAGTATGGATAAGG - Intergenic
937944243 2:127317243-127317265 CTTAAAAAGAAGTAGAGACAAGG - Intronic
938211656 2:129470652-129470674 CTCAGAAACCAGCAGGAAAAAGG - Intergenic
938775033 2:134534106-134534128 CTCAAAAAGCAGCCAGCTCAGGG + Intronic
938806409 2:134810441-134810463 CTAGAAAAGCACCAGAGACAGGG + Intergenic
939851641 2:147312422-147312444 CTAGAAAAGCACCAGAGACAGGG - Intergenic
941243195 2:163067703-163067725 CTAGAAAAGCACCAGAGACAGGG - Intergenic
941412483 2:165177051-165177073 ATCACCAACCAGCAGGGACATGG + Intronic
941537762 2:166743117-166743139 CTGGAAAAGCACCAGAGACAGGG + Intergenic
942844324 2:180404696-180404718 CCCATAAAGAAGCAGGGATAGGG - Intergenic
943593630 2:189829417-189829439 GTTAAAAAGCAGTAGGAACAAGG - Intronic
943715995 2:191152295-191152317 CTCAACAAGCAGTGGGGACCAGG - Intergenic
944806286 2:203284706-203284728 CTCAAAAACCACCTGGGAGATGG - Intronic
945159596 2:206875789-206875811 CACTAGAAGCAACAGGGACATGG - Intergenic
945773949 2:214081465-214081487 CATAAAAAGAAGAAGGGACAGGG + Intronic
945924559 2:215790074-215790096 CTTAGAAAGCAGCAGGGCCATGG + Intergenic
946207577 2:218120978-218121000 CTAGAAAAGCACCAGAGACAGGG + Intergenic
946210367 2:218142963-218142985 CCCAGCAACCAGCAGGGACAGGG + Intergenic
946378204 2:219327067-219327089 CTCAAAAAACAGCAGGGTCCAGG + Intergenic
946644986 2:221823728-221823750 TTCAAAATGGAGCAGGGGCAGGG + Intergenic
947936124 2:234005441-234005463 CTTAAAAATCAGCATGGAAAGGG - Intronic
947966743 2:234288616-234288638 CTTAAAAAGCAGCATGGGCTGGG - Intergenic
948791178 2:240377627-240377649 CTCAAAAAGCAGCAGGGGTGGGG + Intergenic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1169647838 20:7833580-7833602 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1171520316 20:25770625-25770647 CTCAAGTAGCATCAGGGCCAAGG + Intronic
1171556603 20:26085868-26085890 CTCAAGTAGCATCAGGGCCAAGG - Intergenic
1172340430 20:34153465-34153487 CTAGAAAAGCACCAGAGACAAGG - Intergenic
1172425705 20:34854620-34854642 CTGAAAATACAGCAGGGATATGG + Intronic
1172802404 20:37585383-37585405 TTCAAAAAGCCACTGGGACATGG - Intergenic
1172822455 20:37749509-37749531 CTCAGAAAACAGGAGGGAAATGG - Intronic
1173628529 20:44491944-44491966 CTCAAAGACCAGAAGGGACCTGG + Exonic
1173676025 20:44836331-44836353 CATAAAAATCAGCAGTGACATGG - Intergenic
1174164405 20:48574631-48574653 CTCCAAAAGCAGCTGGACCAAGG + Intergenic
1175809996 20:61852731-61852753 CTGGAAAAGCAGCAGAGACAGGG - Intronic
1176286982 21:5023513-5023535 CTCAAGACCCAGCATGGACAGGG - Intronic
1176654451 21:9576912-9576934 CTCAAGTAGCATCAGGGCCAAGG + Intergenic
1177134857 21:17297847-17297869 CTAGAAAAGCACCAGGGATAGGG - Intergenic
1177962193 21:27680936-27680958 CTAAAAACACACCAGGGACAGGG + Intergenic
1179266415 21:39807433-39807455 CTCCCAATGCGGCAGGGACAAGG - Intergenic
1179648111 21:42787940-42787962 TAGAAAAAGCAGCAGGGACTTGG - Intergenic
1179870199 21:44239962-44239984 CTCAAGACCCAGCATGGACAGGG + Intronic
1180966221 22:19789213-19789235 GTCAGAGAGCAGCAGAGACAGGG + Intronic
1181164684 22:20976952-20976974 GACAGAAAGCAGCAGGGAGAAGG - Intronic
1181280663 22:21717742-21717764 CCCAAAAGGCAGCAGAGAAAGGG + Intronic
1181427838 22:22855787-22855809 ACCAAAAGGCAGGAGGGACAGGG + Intronic
1182243035 22:28932409-28932431 CTCCAAAGGCAGCAGGCACCAGG - Intronic
1182458316 22:30466904-30466926 CTCAGTAAGCAGCTGGGTCATGG + Intronic
1182646437 22:31813621-31813643 CTCTAAAAGCAACAGGAAGAAGG - Intronic
1182961931 22:34483435-34483457 CTCAATAAGCCCGAGGGACAAGG + Intergenic
1183594221 22:38800344-38800366 CTCAGAAGGCATGAGGGACAGGG + Intergenic
1184350168 22:43938014-43938036 CTCACACAGTAGAAGGGACAAGG - Intronic
1184557107 22:45239617-45239639 GTCACACAGCTGCAGGGACATGG - Intronic
1184963867 22:47952219-47952241 CTCAAAAAGCATCAGAGAGAGGG - Intergenic
1184985975 22:48134430-48134452 CCCAAAAATCACCAGGGACATGG + Intergenic
1185190990 22:49435937-49435959 CACAGAAACCAGCAGGGGCATGG - Intronic
1185235101 22:49707728-49707750 TTCAAAAATTAGCTGGGACAGGG - Intergenic
1185238121 22:49726337-49726359 CTCAAAGAGAAGCAGGTTCATGG - Intergenic
950028903 3:9838999-9839021 CTCAGAAAGCAGCAGGCAGGTGG + Intronic
950428439 3:12937300-12937322 CTCAAGATGCACCAGGGCCAGGG - Intronic
950562590 3:13743379-13743401 CTCCAAAAGGAGGAGGGAGAGGG - Intergenic
950994378 3:17479985-17480007 CTTTCAAAGCTGCAGGGACAAGG - Intronic
951020268 3:17775438-17775460 CTAGAAAAGCACCAGAGACAGGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951239255 3:20270728-20270750 CTAGAAAAGCACCAGAGACAGGG - Intergenic
951385323 3:22034489-22034511 CTCAAAAAGCAGAATTTACATGG + Intronic
951462713 3:22968649-22968671 TCCAAAAAGCAGCAGGGAAAAGG + Intergenic
951889171 3:27552754-27552776 GTGGAAAAGCAGCAGAGACACGG + Intergenic
952555273 3:34523351-34523373 CTAGAAAAGCACCAGTGACAGGG + Intergenic
952681272 3:36096128-36096150 CTCAAAAACCTGCTGGGAAATGG + Intergenic
953194957 3:40723689-40723711 ATAAGAAAGCAGCAGAGACAAGG - Intergenic
953398946 3:42595726-42595748 CAAAAAAAGGAGCAGGGACCTGG - Intronic
953535999 3:43777228-43777250 CTCCAAAAGCAGTAATGACAGGG - Intergenic
954076500 3:48185715-48185737 CACAAAAGGCAGCAGGGTGAAGG + Intronic
954525949 3:51271423-51271445 CTCACATAGCAGAAGGGGCAAGG + Intronic
954586755 3:51743267-51743289 CTAGAAAAGCACCAGAGACAGGG - Intergenic
954598701 3:51851116-51851138 CTAGAAAAGCACCAGAGACAGGG - Intergenic
954764575 3:52902639-52902661 CTCACAAAGCTGCTGGGACTGGG - Intergenic
955051373 3:55414329-55414351 CTTAGAGAGTAGCAGGGACATGG + Intergenic
956273988 3:67477804-67477826 CTCAAAGAGCAGCAGAAATATGG + Intronic
957387036 3:79509401-79509423 CTAAAAAAGCTGCTGGGATATGG + Intronic
958549445 3:95594531-95594553 CTAGAAAAGCACCAGAGACAGGG + Intergenic
958576012 3:95950500-95950522 CTAGAAAAGCACCAGAGACAGGG + Intergenic
958601161 3:96298669-96298691 CTAGAAAAGCACCAGAGACAGGG - Intergenic
958658581 3:97036006-97036028 CTCACAAGGCAGATGGGACAAGG - Intronic
959371080 3:105526761-105526783 AGCAAAAAGCAGCTGTGACAGGG + Intronic
959519809 3:107312554-107312576 CTCAAAAATCAGCACAGACAAGG - Intergenic
959755811 3:109897671-109897693 CTAAAATAGCAGCAATGACAAGG - Intergenic
960666252 3:120111831-120111853 CTCAAAAAGCAAGAGGGTGAGGG + Intergenic
961140211 3:124549774-124549796 CTCCAAAAGCAGGAAAGACAGGG + Intronic
961261432 3:125605313-125605335 CTAGAAAAGCACCAGAGACAGGG - Intergenic
961558924 3:127715533-127715555 TTAAAAGAGCAGCAGGGAAAGGG - Intronic
963099994 3:141592114-141592136 ACAAAAAAGAAGCAGGGACAAGG + Intronic
963409423 3:144908781-144908803 CTAGAAAAGCACCAGAGACAGGG + Intergenic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
964972022 3:162575490-162575512 CTAGAAAAGCACCAGAGACAGGG - Intergenic
965062517 3:163802625-163802647 CTAGAAGAGCACCAGGGACAGGG - Intergenic
967086709 3:186101673-186101695 CTCACAAAGCTGCAGAGCCAGGG - Intronic
967137844 3:186527601-186527623 GTCAAAAAACAGAAGGGGCATGG - Intergenic
967583407 3:191186479-191186501 CTAGAAAAGCACCAGAGACAGGG - Intergenic
968470622 4:780923-780945 CTCAGTGGGCAGCAGGGACAGGG - Intergenic
969188598 4:5498946-5498968 CTCAGGAGGCAGCAGGGACAGGG + Exonic
969297009 4:6276171-6276193 CTCACACAGCAGCAGGTTCAAGG + Intronic
969677146 4:8620408-8620430 GTCAAAAAGCAGCAGAGACCTGG + Intergenic
969678099 4:8626047-8626069 GTCAAAAAGCAGCAGAGACCTGG + Intergenic
969679054 4:8631684-8631706 GTCAAAAAGCAGCAGAGACCTGG + Intergenic
970017160 4:11524978-11525000 ATGAAATAGCAGCAGGAACATGG - Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
971354286 4:25880446-25880468 TTTAGAAAGCAGCGGGGACAGGG - Intronic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971502358 4:27330891-27330913 CTCTACCAGCAGCAGGGACTGGG + Intergenic
971550411 4:27948465-27948487 CTCAGAAATCTGCAGTGACAAGG + Intergenic
971578258 4:28304048-28304070 CTAGAAAAGCACCAGAGACAGGG - Intergenic
972323614 4:37994663-37994685 CTTTAAAAGCAGCAGCAACAAGG - Intronic
973549806 4:52022436-52022458 CTCACACAGAATCAGGGACAGGG - Exonic
973588604 4:52417461-52417483 CACAAAAAGCAGGGGAGACAAGG + Intergenic
974061284 4:57038241-57038263 TTCACAATGCAGCAGGGAGAAGG + Intronic
974187084 4:58459131-58459153 CTAGAAAAGCACCAGAGACAGGG - Intergenic
974526332 4:63053900-63053922 CTGGAAAAGCAACAGAGACAGGG - Intergenic
974839078 4:67281335-67281357 CTAGAAAAGCACCAGAGACAAGG + Intergenic
975975430 4:80090272-80090294 CTGGAAAAGCAGCAGAGACTGGG + Intronic
976174561 4:82338065-82338087 CTAGAAAAGCACCAGAGACAGGG + Intergenic
977252215 4:94702053-94702075 CACAAAAAGCCGCAGAGACCTGG - Intergenic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
978146874 4:105385196-105385218 GACAAAAATGAGCAGGGACAAGG - Intronic
978828753 4:113056755-113056777 TTTAAAAAGCTGCAGGGAGAAGG + Intronic
980291132 4:130848245-130848267 CTAGAAAAGCACCAGAGACAGGG + Intergenic
981588058 4:146325958-146325980 CACAAAAAGCAGCAGGAGCAGGG + Exonic
981827173 4:148956589-148956611 TTCAATGAGCAGCAGGGCCAGGG - Intergenic
982225217 4:153158864-153158886 CTCAAAAGGCTGCAGGAGCATGG + Intronic
983141099 4:164150597-164150619 CTCAAAAAGAACCAAGGTCAAGG - Intronic
983366950 4:166803476-166803498 CTCAAAAAGCAGGAGCAACTAGG + Intronic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983601000 4:169527718-169527740 ATCTAAAGGCAGCAGGGAAATGG + Intronic
984033915 4:174641445-174641467 CTCACAAGGCAACAGTGACAAGG - Exonic
984591616 4:181623971-181623993 CTCAAAAAGGAGCAAGGACAAGG - Intergenic
985685566 5:1279904-1279926 CACAAGAAGCAGCCGGGCCAGGG - Intronic
986124384 5:4871836-4871858 GTCATAAAGAAGCAGTGACAGGG + Intergenic
986374667 5:7117819-7117841 CTCAGATAGCAGAAGGAACAAGG - Intergenic
986550707 5:8951663-8951685 TTCACAAAGCAGCAGGTAGATGG - Intergenic
987929648 5:24388078-24388100 CTAGAAAAGCACCAGAGACAGGG - Intergenic
988373126 5:30398432-30398454 CTCAAAATGCATAAGGTACAAGG + Intergenic
988605745 5:32677090-32677112 CTAGAAAAGCACCAGAGACAGGG + Intergenic
989137155 5:38167037-38167059 CTCAGAGGGCAGCAGGGCCATGG - Intergenic
989501101 5:42169225-42169247 CTTAAAAAGAAGCAGGGGAAGGG - Intergenic
989797213 5:45490465-45490487 CTCAGAAAGAGGAAGGGACAAGG - Intronic
990368118 5:55090286-55090308 CTAGAAAAGCACCAGAGACAGGG + Intergenic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
992049120 5:72927281-72927303 CTAGAAAAGCACCAGAGACAGGG - Intergenic
992454970 5:76908460-76908482 CTAGAAAAGCACCAGAGACAGGG - Intronic
993663886 5:90671238-90671260 CACTAAAAGTAGCAGAGACAGGG - Intronic
997024948 5:130048555-130048577 TTCAAAAATCTGCAGAGACAGGG - Intronic
997072160 5:130634567-130634589 CTAGAAAAGCACCAGAGACAGGG - Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
1000084989 5:157880973-157880995 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1000640783 5:163699249-163699271 CACAAAAAGAACCAGTGACAAGG - Intergenic
1000681227 5:164187540-164187562 GTGAAAAAGCAGCATGGTCAGGG - Intergenic
1000757612 5:165181242-165181264 CTGAAAGAGCACAAGGGACATGG - Intergenic
1000925731 5:167191898-167191920 ATGACAAGGCAGCAGGGACAGGG + Intergenic
1001715725 5:173814267-173814289 CTCTAAAAGCAGCAGAAACAAGG - Intergenic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1003805548 6:9723185-9723207 CTAGAAAAGCACCAGAGACAGGG - Intronic
1004037274 6:11935637-11935659 GTCAACAGGCAGCAGGGTCATGG - Intergenic
1004228808 6:13813530-13813552 CTAGAAAAGCGCCAGGGACAGGG + Intronic
1004531139 6:16456739-16456761 CTGGAAGAGCACCAGGGACAGGG - Intronic
1006221546 6:32496000-32496022 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1006580992 6:35077999-35078021 CTCAGAAAACAGCACGGACTGGG + Intronic
1008849554 6:56008303-56008325 GACAAAAAGCAGGAGGGAAATGG - Intergenic
1009386182 6:63085786-63085808 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1009872540 6:69469196-69469218 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1010074725 6:71786608-71786630 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1010129217 6:72471236-72471258 CTCAACAAGCAGAAGAGACTGGG + Intergenic
1010269584 6:73904852-73904874 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1011375267 6:86680324-86680346 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1011796174 6:90955046-90955068 CTCAAAGTACAGCATGGACAAGG - Intergenic
1011916449 6:92511884-92511906 CCATGAAAGCAGCAGGGACAGGG + Intergenic
1012441778 6:99267663-99267685 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1012797532 6:103781436-103781458 CGCAAAAAGCTGCAGGGAAGGGG + Intergenic
1012840299 6:104321126-104321148 CCCAGACAGCAGCAGGGACTTGG + Intergenic
1013095957 6:106945003-106945025 CCCCAAAAGCAGCAGGCCCAGGG - Intergenic
1013908091 6:115240172-115240194 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1013977176 6:116092060-116092082 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1015347312 6:132175095-132175117 TTCACAAAGCAGCAGGGCCCTGG + Intergenic
1015725484 6:136295249-136295271 CTCAAAATCCAGCAGAGAGAGGG + Intergenic
1016183777 6:141177133-141177155 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1016508455 6:144812398-144812420 CACAAGAAGCAGCAAGGATAAGG - Intronic
1016589726 6:145730958-145730980 CTCTAAACACAGCAGGGAAAGGG + Intronic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017101073 6:150850351-150850373 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1018369972 6:163158764-163158786 CTCACACTGCAGCAGGCACAGGG + Intronic
1018825587 6:167406015-167406037 TGCAGAAAGCAGCAGGGAGAAGG + Intergenic
1019062418 6:169265897-169265919 GTTGAAAAGCAGCAGGGACAGGG + Intergenic
1019406534 7:887036-887058 CTCCCAGAGCAGCAGGGACTAGG - Intronic
1020752442 7:12159940-12159962 CTCACAAAGCAACAGGAACTAGG - Intergenic
1021356836 7:19660138-19660160 CTAGAAAAGCACCAGAGACAAGG + Intergenic
1022823676 7:33986997-33987019 CTCAAGTAGGACCAGGGACAGGG - Intronic
1023078188 7:36503700-36503722 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1023151292 7:37203629-37203651 CTAGAAAAGCACCAGAGACAGGG + Intronic
1023542624 7:41282668-41282690 CTCAAAAGGGAACAGGGAGAAGG + Intergenic
1023542671 7:41283043-41283065 CTCAAGAGGCAACAGGGAGAGGG + Intergenic
1023831445 7:44040840-44040862 CTCTCACAGCAGCCGGGACACGG + Intergenic
1024603637 7:51008093-51008115 CTCCAGAAGCAGCAGGGAATGGG + Intergenic
1024735045 7:52295864-52295886 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1024871023 7:53961794-53961816 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1026678251 7:72446413-72446435 CTCAAAAGGCACAAGGGACAGGG + Intronic
1027195338 7:76026222-76026244 AAAAAAAAGCAGCAGAGACAGGG + Intronic
1027607878 7:80322877-80322899 CTCACACAGAAGCAGGCACAAGG - Intergenic
1027790875 7:82638060-82638082 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1028495471 7:91455440-91455462 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1029648545 7:101874379-101874401 CTTAAAAAGCAGCGGAAACATGG + Intronic
1030174228 7:106633807-106633829 CTGGAAAAGCCCCAGGGACAGGG - Intergenic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1032713825 7:134487146-134487168 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1032826622 7:135576051-135576073 CCTAAACACCAGCAGGGACATGG - Intronic
1033023918 7:137754399-137754421 TTCAAACATCAGCAGGCACAGGG + Intronic
1033708315 7:143910396-143910418 CTTAAAAGGCTGCAAGGACAAGG - Intergenic
1034477943 7:151298517-151298539 CACCAAAAGCAGCAGGGAAGGGG + Intergenic
1034580241 7:152035318-152035340 CTAGAAAAGCACCAGAGACAGGG + Intronic
1035980141 8:4361231-4361253 CTCAAAAAGCAGGAAGGAAAAGG + Intronic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1037192251 8:16140819-16140841 CCCAAACAGCACCAGGGACCAGG + Intronic
1037346371 8:17905604-17905626 CTCAAAATGCTGCAGATACAAGG - Intronic
1038046832 8:23772621-23772643 CTACAAAAGCAGTAGGGAGAAGG + Intergenic
1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG + Intronic
1038762647 8:30398850-30398872 AAAAAAAAGGAGCAGGGACAAGG - Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039275752 8:35933013-35933035 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1039373477 8:37010540-37010562 CACAACAAGCACCAGAGACAGGG + Intergenic
1039999947 8:42567269-42567291 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1040000233 8:42569561-42569583 CTCAGAAAGCAGCAGGTCTATGG + Intergenic
1040526937 8:48233932-48233954 CTAGAAAAGCACCAGAGACAAGG - Intergenic
1040668109 8:49655940-49655962 CTACAAAAGCACCAGAGACAGGG + Intergenic
1040953149 8:52955690-52955712 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1040965313 8:53076126-53076148 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1041001655 8:53460554-53460576 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1041454716 8:58045956-58045978 TTCACAAGGCAGAAGGGACAAGG + Intronic
1041781930 8:61586197-61586219 CCCAAGGAGCAGCAGGGAGAAGG - Intronic
1041988530 8:63955908-63955930 CTCAAAAAGCAGTAGAGGGATGG - Intergenic
1042147280 8:65743291-65743313 TTCAAAAAGGAGAAGGGCCAAGG + Intronic
1042771671 8:72389027-72389049 CTAAAAGAGCACCAGGGACAGGG - Intergenic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1043706883 8:83361210-83361232 ATCAAAAAGGAGCAGGGAGGTGG + Intergenic
1044456879 8:92399916-92399938 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1045489478 8:102657429-102657451 CGCAGACAGAAGCAGGGACATGG - Intergenic
1045858309 8:106789624-106789646 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1048021711 8:130545786-130545808 CTGACACAGCAGCAGGCACATGG - Intergenic
1048247110 8:132817783-132817805 ATAAAAAAGAAGCAGGGAGAAGG - Intronic
1048372626 8:133792783-133792805 CTCCAACAGCAGCGAGGACAAGG + Intergenic
1052058031 9:23924904-23924926 CTAGAAAAGCACCAGAGACAAGG + Intergenic
1052234350 9:26191989-26192011 CTCACATAGTGGCAGGGACAAGG - Intergenic
1053286445 9:36852382-36852404 CTCAGAAAGGAGAAGGGACTTGG + Intronic
1053532586 9:38897093-38897115 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1053946120 9:43311652-43311674 CGCAAAAAGCAGCGGCGGCAGGG - Intergenic
1054204809 9:62121514-62121536 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1054633549 9:67466844-67466866 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1055458518 9:76494660-76494682 CTAGAAAAGCACCAGAGACAGGG + Intronic
1056393042 9:86156299-86156321 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1058629356 9:106970577-106970599 TTCAAAAAGCAGGGGGGAAAGGG - Intronic
1059489470 9:114655246-114655268 CTCACATAGCAGAAGGGGCAAGG - Intergenic
1059735053 9:117092391-117092413 CTCAGAGACCAGCAGGGACTTGG + Intronic
1203589248 Un_KI270747v1:40210-40232 CGCAAAAAGCAGCGGCGGCAGGG - Intergenic
1203632171 Un_KI270750v1:80370-80392 CTCAAGTAGCATCAGGGCCAAGG + Intergenic
1185711738 X:2309649-2309671 CTCAAAATGCTACAGTGACAGGG - Intronic
1186184156 X:7003602-7003624 GTCTAAAAGCAGCAGGAACCTGG - Intergenic
1186957894 X:14703004-14703026 TTCAAAGAGCAGCAGTGCCATGG + Intronic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1188622241 X:32240391-32240413 CTCACAAGGCAGCAGGTCCAAGG - Intronic
1189015229 X:37090089-37090111 AAAAAAAAGGAGCAGGGACAAGG - Intergenic
1192483074 X:71501406-71501428 CTAGAAAAGCACCAGAGACAGGG + Intronic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1196488731 X:116244469-116244491 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1197513145 X:127395996-127396018 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1197827888 X:130610194-130610216 CTCACAAAGCAGAAGGCAGAAGG - Intergenic
1197925897 X:131646918-131646940 CTCAGACAGCAGCAGGAACAGGG - Intergenic
1197998775 X:132410037-132410059 CTCAAAAAGCAGCAAGCAGGGGG + Intronic
1198612969 X:138422397-138422419 CTTAACAAGCGGCAGGGAGATGG + Intergenic
1198816899 X:140600919-140600941 CTAAAAGACCAGCAGGGCCAGGG - Intergenic
1199002329 X:142653837-142653859 CTCCAAAGGCAACATGGACAGGG - Intergenic
1200122588 X:153798145-153798167 CCCAAAAAGGAGGAGGGACCAGG - Intronic
1200306900 X:155035283-155035305 CACATAAAGCAGCGGGGAAAGGG - Intronic
1200695195 Y:6352391-6352413 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1201040082 Y:9822319-9822341 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1201312298 Y:12607750-12607772 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1201403535 Y:13628803-13628825 CTAGAAAAGCGGCAGAGACAGGG - Intergenic
1201526698 Y:14944072-14944094 CTAGAAAAGCACCATGGACAGGG + Intergenic
1201649147 Y:16265927-16265949 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1201653662 Y:16319373-16319395 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1201744206 Y:17352873-17352895 CTAGAAAAGCACCAGAGACAGGG + Intergenic
1202257606 Y:22938106-22938128 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1202410596 Y:24571853-24571875 CTAGAAAAGCACCAGAGACAGGG - Intergenic
1202460185 Y:25098219-25098241 CTAGAAAAGCACCAGAGACAGGG + Intergenic