ID: 912416589

View in Genome Browser
Species Human (GRCh38)
Location 1:109512451-109512473
Sequence CAGAAAGAGGAAAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912416589_912416598 20 Left 912416589 1:109512451-109512473 CCGGCCTCCCTTTCCTCTTTCTG No data
Right 912416598 1:109512494-109512516 AGAGACAGATAGAAAGAAAAAGG No data
912416589_912416595 -6 Left 912416589 1:109512451-109512473 CCGGCCTCCCTTTCCTCTTTCTG No data
Right 912416595 1:109512468-109512490 TTTCTGCTGTGTCCAAGGCGTGG No data
912416589_912416596 -5 Left 912416589 1:109512451-109512473 CCGGCCTCCCTTTCCTCTTTCTG No data
Right 912416596 1:109512469-109512491 TTCTGCTGTGTCCAAGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912416589 Original CRISPR CAGAAAGAGGAAAGGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr