ID: 912420762

View in Genome Browser
Species Human (GRCh38)
Location 1:109540768-109540790
Sequence CTGTCTGTTAAGAGGTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912420759_912420762 -2 Left 912420759 1:109540747-109540769 CCATTAGCCAGATACACTGATCT No data
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420756_912420762 21 Left 912420756 1:109540724-109540746 CCAGTCCATTAGTGAGGGAGTGC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420754_912420762 23 Left 912420754 1:109540722-109540744 CCCCAGTCCATTAGTGAGGGAGT 0: 1
1: 0
2: 0
3: 11
4: 101
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420757_912420762 16 Left 912420757 1:109540729-109540751 CCATTAGTGAGGGAGTGCCCATT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420751_912420762 29 Left 912420751 1:109540716-109540738 CCATAACCCCAGTCCATTAGTGA 0: 1
1: 0
2: 0
3: 13
4: 182
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420760_912420762 -9 Left 912420760 1:109540754-109540776 CCAGATACACTGATCTGTCTGTT 0: 1
1: 0
2: 1
3: 8
4: 185
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420758_912420762 -1 Left 912420758 1:109540746-109540768 CCCATTAGCCAGATACACTGATC No data
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data
912420755_912420762 22 Left 912420755 1:109540723-109540745 CCCAGTCCATTAGTGAGGGAGTG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912420762 Original CRISPR CTGTCTGTTAAGAGGTAAAT TGG Intronic
No off target data available for this crispr