ID: 912422923

View in Genome Browser
Species Human (GRCh38)
Location 1:109558248-109558270
Sequence TTGTATTTTCAGAAAAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912422923_912422930 24 Left 912422923 1:109558248-109558270 CCCCGTCTTTTCTGAAAATACAA No data
Right 912422930 1:109558295-109558317 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
912422923_912422933 28 Left 912422923 1:109558248-109558270 CCCCGTCTTTTCTGAAAATACAA No data
Right 912422933 1:109558299-109558321 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
912422923_912422927 -6 Left 912422923 1:109558248-109558270 CCCCGTCTTTTCTGAAAATACAA No data
Right 912422927 1:109558265-109558287 ATACAAAAATTAGCCAGGCGTGG 0: 13467
1: 57620
2: 94104
3: 129416
4: 125446
912422923_912422928 -3 Left 912422923 1:109558248-109558270 CCCCGTCTTTTCTGAAAATACAA No data
Right 912422928 1:109558268-109558290 CAAAAATTAGCCAGGCGTGGTGG 0: 13383
1: 72342
2: 151897
3: 208982
4: 175790
912422923_912422931 25 Left 912422923 1:109558248-109558270 CCCCGTCTTTTCTGAAAATACAA No data
Right 912422931 1:109558296-109558318 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912422923 Original CRISPR TTGTATTTTCAGAAAAGACG GGG (reversed) Intronic
No off target data available for this crispr