ID: 912429421

View in Genome Browser
Species Human (GRCh38)
Location 1:109621148-109621170
Sequence GGACCACGGCGGCGACAGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912429421_912429434 19 Left 912429421 1:109621148-109621170 CCCCGCTGTCGCCGCCGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 912429434 1:109621190-109621212 ATCTGGCTCTGGCAAGCCCAAGG 0: 1
1: 0
2: 1
3: 19
4: 209
912429421_912429431 8 Left 912429421 1:109621148-109621170 CCCCGCTGTCGCCGCCGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 912429431 1:109621179-109621201 GCATCCTATCCATCTGGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 285
912429421_912429429 2 Left 912429421 1:109621148-109621170 CCCCGCTGTCGCCGCCGTGGTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 912429429 1:109621173-109621195 GCCATGGCATCCTATCCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912429421 Original CRISPR GGACCACGGCGGCGACAGCG GGG (reversed) Exonic
900368992 1:2323179-2323201 GGACCACGGGGGACACCGCGTGG + Intronic
905239349 1:36571977-36571999 GGACCAGGGTGGGGACAGCTGGG - Intergenic
912361636 1:109100485-109100507 GGACCTCGGGGACCACAGCGTGG - Intergenic
912429421 1:109621148-109621170 GGACCACGGCGGCGACAGCGGGG - Exonic
915325301 1:155078851-155078873 GGCCGACGGCGGCGGCAGCAGGG + Exonic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
923369427 1:233295582-233295604 CGACGGCGGCGGCGACGGCGGGG - Exonic
1069023983 10:63521168-63521190 GGGCCAAGGCCGCGGCAGCGAGG + Intergenic
1072591658 10:96832837-96832859 GGACGGCGGCGGCCACAGCGCGG - Intronic
1073110916 10:101062591-101062613 GGGCCGCGGCGGCGGCAGCATGG - Exonic
1077066057 11:641334-641356 GGAGCAGGGAGGCGGCAGCGGGG + Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1081872665 11:46390679-46390701 CGACCACGGCGGAGACATGGAGG - Intergenic
1082175177 11:49049943-49049965 GGAGCACGGCGTCGAGGGCGTGG - Intergenic
1082657994 11:55874369-55874391 GGAGCACGGCGTCGAGGGCGTGG - Intergenic
1085454651 11:76658928-76658950 GGGCCACGGCGGCTCCAGCAGGG - Exonic
1086690590 11:89786141-89786163 GGAGCACGGCGTCGAGGGCGTGG + Intergenic
1086697932 11:89865381-89865403 GGAGCACGGCGTCGAGGGCGTGG - Intergenic
1086708230 11:89979107-89979129 GGAGCACGGCGTCGAGGGCGTGG + Intergenic
1086715209 11:90053519-90053541 GGAGCACGGCGTCGAGGGCGTGG - Intergenic
1095998002 12:48105821-48105843 GGCCACCGGCGGCCACAGCGCGG + Intronic
1104861179 12:131924733-131924755 GGATCACGGCGCCCACAGCCTGG - Intergenic
1104943413 12:132405213-132405235 GGCCCTCGGCGGGGACAGCTGGG - Intergenic
1113707815 13:112445643-112445665 GGACCAGGGCGGGGAGAGCCCGG - Intergenic
1113936909 13:113999701-113999723 GGACCCCAGCCGGGACAGCGGGG - Intronic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115257738 14:31420556-31420578 TGCCGGCGGCGGCGACAGCGAGG + Exonic
1119856865 14:77907653-77907675 GGACCTCAGCGGTGACAGTGGGG - Intronic
1121103268 14:91264460-91264482 GGTTGACGGCGGCGCCAGCGCGG - Intergenic
1122494200 14:102140223-102140245 GGAGCAGGGCGGTGACAGTGGGG + Intronic
1122736637 14:103847396-103847418 AGAGCACGGCGGCGGGAGCGCGG - Exonic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1132330498 15:101009099-101009121 GGAGCACAACGGTGACAGCGGGG - Intronic
1132848052 16:2009730-2009752 GGACCATGGCGGCGGCCGGGGGG - Exonic
1132925863 16:2428967-2428989 GGATCACGGCCGCGACTGCGAGG + Intergenic
1141594607 16:85089589-85089611 GGACCACGGCAGCGACAGGCAGG - Exonic
1142142674 16:88479548-88479570 GGGCCACGGTGGGGACAGAGAGG - Intronic
1147377785 17:40033133-40033155 GGATCACGGCGTGGACAGTGGGG + Exonic
1150802280 17:68291600-68291622 GGACCCCGGCGGCGCTGGCGGGG - Intronic
1152680719 17:81666526-81666548 GGACCGCGGCGGCTACCGCCCGG + Exonic
1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1152921368 17:83068172-83068194 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921383 17:83068207-83068229 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921397 17:83068241-83068263 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921421 17:83068309-83068331 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921457 17:83068411-83068433 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921471 17:83068445-83068467 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921495 17:83068513-83068535 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921509 17:83068547-83068569 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921533 17:83068615-83068637 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921539 17:83068627-83068649 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1152921546 17:83068649-83068671 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921560 17:83068683-83068705 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921574 17:83068718-83068740 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921588 17:83068753-83068775 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921602 17:83068788-83068810 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921615 17:83068822-83068844 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1152921630 17:83068857-83068879 GGTCCCGGGAGGCGACAGCGGGG + Intergenic
1153820893 18:8830453-8830475 GGAACACGGCAGAGACAGCATGG - Intronic
1153935089 18:9914174-9914196 GGACGACGGCGGCGACGGCTCGG - Exonic
1155007459 18:21741377-21741399 GGGGCGCGGCGGCGACAGCTGGG + Exonic
1157271686 18:46281135-46281157 CGACCACAGCGGAGACAGTGTGG + Intergenic
1158880991 18:61779630-61779652 GGACCACGGCGGCGGGGGGGTGG - Intergenic
1159206012 18:65253802-65253824 TGAACACGACTGCGACAGCGGGG + Intergenic
1159798237 18:72868237-72868259 GGGCCGCGGCGGCGGCAGCAAGG + Intergenic
1160454543 18:78991607-78991629 GGACCACACCGGCCACAGCGCGG + Intronic
1161085571 19:2333407-2333429 GGACCACGGCGGACACTGCAGGG - Intronic
1162145510 19:8610664-8610686 AGACAGCGGCGGCGACGGCGCGG - Intronic
1162751495 19:12832788-12832810 GGACGACGGGGGCGACGGCGAGG - Intronic
1163631397 19:18419620-18419642 GGGCCCCGGCGGCGGCGGCGTGG + Exonic
1165493655 19:36140008-36140030 GGACCGCGCGGGCGACAGCAGGG + Exonic
1166160428 19:40948706-40948728 GGAGCACAGCGGCGACATCTCGG - Intergenic
1166960678 19:46494262-46494284 GGACCACGGCGTCCACCTCGCGG + Exonic
1167454493 19:49591353-49591375 GGGCAAAGGCGGAGACAGCGGGG + Intergenic
1168075312 19:53978195-53978217 GGACTACGACCACGACAGCGCGG + Exonic
925973195 2:9122115-9122137 GGACCATGGGGGCAACAGGGAGG + Intergenic
927920766 2:26970677-26970699 AGACCGCGGCGGCCTCAGCGAGG + Exonic
932042986 2:68319541-68319563 GGCGGACGGCGGCGACGGCGCGG - Exonic
932419933 2:71595721-71595743 GGACCACGGCTGCCCCAGGGAGG - Intronic
934278143 2:91589585-91589607 GGACCTCGGGGCCGACGGCGAGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934771699 2:96911708-96911730 GCACCAAGGCAGCGACAGGGAGG + Intronic
936475202 2:112833570-112833592 GGAGCACTGCGGAGAGAGCGAGG + Exonic
938796106 2:134719155-134719177 GGAGCGCGGCGGCAACAACGCGG - Intergenic
944221716 2:197310381-197310403 GGCCCAGGGCGGGGACGGCGCGG + Intronic
944547587 2:200812528-200812550 GGACCCCATCGGCCACAGCGGGG - Intronic
946419732 2:219557997-219558019 AGACCACGGGGGCGCCAGCCCGG + Exonic
948078720 2:235187990-235188012 TGGCCAGGGCGGTGACAGCGAGG - Intergenic
948438128 2:237967396-237967418 TGACCGCGGCGGCGGCGGCGGGG + Intronic
948526944 2:238576672-238576694 GGACCACGGAGGAGAGAGTGGGG - Intergenic
1173827581 20:46057563-46057585 GGTCCGCGGCGGCGGCCGCGAGG + Exonic
1179810216 21:43865268-43865290 GGAGCGCGGCGGCCAGAGCGGGG + Intronic
1182880050 22:33725292-33725314 GGAGCACAGAGGCGACAGGGTGG + Intronic
1183079883 22:35449575-35449597 GGGCCACGGCTGGGACAGAGAGG - Intergenic
1183079888 22:35449595-35449617 AGACCACGGCTGGGACAGAGGGG - Intergenic
1183649410 22:39145547-39145569 GGACCGCGGCGTGGACACCGGGG + Intronic
1185231556 22:49686900-49686922 GGACCACGGCCGCCACACCCCGG + Intergenic
954110108 3:48429008-48429030 GGTCCCCGGCGGCGACGGCGAGG + Intronic
955226214 3:57062442-57062464 GGAGCACGGCGGCGGGGGCGGGG + Intronic
961393186 3:126568829-126568851 GGACCACAGAGGCGGCAGGGGGG + Intergenic
963904456 3:150762660-150762682 GGGCCCCGGCGGCGGCGGCGGGG - Exonic
966872436 3:184299569-184299591 GGACGGCGGAGGTGACAGCGCGG - Intronic
968904655 4:3445711-3445733 GGACCCCGGCGGGGCCAGCCCGG + Intronic
969525764 4:7703312-7703334 GGACCACGGCGGCGTGATCGTGG + Exonic
970636962 4:18021123-18021145 GGCCCCCGGCGGCGACAAGGGGG + Intronic
978366653 4:107989906-107989928 TGGCAGCGGCGGCGACAGCGAGG - Exonic
982573189 4:157076087-157076109 GGGCCGCAGCGGGGACAGCGCGG - Exonic
985560045 5:580667-580689 GGACCTTTGCGGCCACAGCGAGG + Intergenic
986152588 5:5140637-5140659 GGAAAACAGCGGCGACATCGCGG - Intronic
986721676 5:10564662-10564684 GGAGCACGGCGTCGAGAGCGCGG + Exonic
989039217 5:37209315-37209337 GGGCCACGGCGGGGCGAGCGAGG + Intronic
990008564 5:50969349-50969371 GGACCACGCGGGCGAGAGCAAGG + Intergenic
1000091282 5:157931594-157931616 TGACCTCGGCGGCGTCAGGGAGG + Intergenic
1001848447 5:174941846-174941868 TGACCAGGGCGGAGACAGCTGGG + Intergenic
1006173643 6:32109314-32109336 GGATCTCGGCAGCGACAGTGAGG + Intronic
1012399995 6:98835068-98835090 GTCCCACGGCGGCGGCGGCGGGG + Exonic
1018893184 6:167996748-167996770 GGACAACAGGGGGGACAGCGGGG + Intronic
1037887916 8:22604816-22604838 GGGCCAGGGCAGCGACACCGGGG - Exonic
1039473764 8:37828831-37828853 GGAGCAGGGCGGCTCCAGCGGGG + Intronic
1049426941 8:142541912-142541934 GGGCCGCGGGGGAGACAGCGGGG - Intronic
1049746864 8:144266691-144266713 GGACCGCGGCAGCGACAGCTCGG + Exonic
1053434905 9:38068288-38068310 GGACTACTGCGGCGGCAGCGGGG - Exonic
1057466248 9:95317257-95317279 GGGCCAGGGCGGGGAAAGCGGGG - Intronic
1057470172 9:95349854-95349876 GGACCCGGGCGGGGACAGAGCGG - Intergenic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060977099 9:127771235-127771257 GGTTGCCGGCGGCGACAGCGGGG - Intronic
1061050474 9:128191854-128191876 GGACCGCGGCGGCCGCAGGGAGG - Intronic
1062425656 9:136505034-136505056 CGACCAGGGCTGCAACAGCGCGG - Exonic
1200047696 X:153411448-153411470 GGGCCGGGGCGGCGGCAGCGTGG - Intergenic