ID: 912429531

View in Genome Browser
Species Human (GRCh38)
Location 1:109621647-109621669
Sequence TGCCTTTACCAGGCAGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912429527_912429531 -4 Left 912429527 1:109621628-109621650 CCACTCTGACTGGCGCCTGTGCC 0: 1
1: 0
2: 3
3: 15
4: 186
Right 912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG 0: 1
1: 0
2: 1
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912429531 Original CRISPR TGCCTTTACCAGGCAGGCTT AGG Intronic
901023613 1:6267551-6267573 GGTCTGTACCAGGCAGGTTTGGG + Intronic
903500867 1:23799660-23799682 GTCCTTTGCCAGGCAGGCTGAGG + Intronic
904011106 1:27391214-27391236 AGCCTCCACCAGGCAGGTTTTGG - Intergenic
904457797 1:30657842-30657864 TGCCTCTGCCTGGCAGGCTCAGG - Intergenic
908070136 1:60451405-60451427 GGTCTTTAAAAGGCAGGCTTTGG + Intergenic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
909790532 1:79672076-79672098 TGCTTTAACCAGGCAGGCAGAGG + Intergenic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
915091811 1:153431583-153431605 TGCTTTTAACCGGAAGGCTTTGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916028230 1:160853982-160854004 TGCATACACCAGGCAGGCCTTGG - Intronic
916918523 1:169437740-169437762 TGCCTTTGCCATGCAAGCCTTGG - Intronic
917687547 1:177432536-177432558 AGCCTTTACCAGGGTGGCATTGG + Intergenic
917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG + Intronic
922204977 1:223438183-223438205 TGCCTTTATCTAGAAGGCTTCGG + Intergenic
924591820 1:245411202-245411224 TGCCTTTCCCTGGCAGGGTCAGG - Intronic
1063424850 10:5942804-5942826 TTCCTTTAAAAGACAGGCTTAGG - Intronic
1063428590 10:5968322-5968344 ATCCTGTACCAGGCAGGCTGGGG + Intronic
1065970904 10:30805358-30805380 TGCCTTTTCCTGTCAGTCTTAGG - Intergenic
1066503873 10:36021910-36021932 GGCCTTGACCTCGCAGGCTTAGG + Intergenic
1067855051 10:49784798-49784820 TGCCTTCCCCATGCAGGCCTGGG + Intergenic
1068116675 10:52743880-52743902 GGCCTTTATCAGGGAGGCCTTGG + Intergenic
1070593876 10:77819259-77819281 TTCCATGTCCAGGCAGGCTTGGG + Intronic
1072395494 10:95035687-95035709 TCCCTTGTCCAAGCAGGCTTAGG - Intergenic
1074032463 10:109702431-109702453 TGTCTTTAACAAGGAGGCTTTGG + Intergenic
1075986202 10:126787452-126787474 TGCCATTAACAGAGAGGCTTTGG - Intergenic
1076161243 10:128245722-128245744 TGCCTTAACCAGGCAGGGATGGG - Intergenic
1081773206 11:45662292-45662314 TGCCTTTAGCGGGAAGGCTGAGG + Intronic
1084408198 11:68991166-68991188 GGCCCTTCCCAGGCGGGCTTGGG + Intergenic
1089466220 11:118688175-118688197 TGCCTCTCCCAGGAGGGCTTTGG - Intergenic
1091564087 12:1635108-1635130 TGCCTTCACGGGGCAGCCTTTGG - Intronic
1092981258 12:13796716-13796738 TGCCATTCCCCTGCAGGCTTGGG + Intronic
1093404974 12:18793260-18793282 TGCCTTTAACAGGAAGTCTCTGG + Intergenic
1094290745 12:28846513-28846535 TGTGTTTACCAAACAGGCTTTGG - Intergenic
1095048446 12:37535134-37535156 TGCATTCACCAAGCAGGCTCAGG - Intergenic
1095800529 12:46267407-46267429 TGCCTTTCACAGGCTGCCTTGGG - Exonic
1096156622 12:49345009-49345031 TGCCTTTTCCAGGCGGGCGGAGG - Intergenic
1097183772 12:57185454-57185476 TGCCTTTGTCATCCAGGCTTTGG - Intronic
1097316004 12:58172333-58172355 TGCCTTTTCCAGGCGGGCTAGGG - Intergenic
1097493395 12:60297564-60297586 TCCCATTACCAGACAGGATTTGG - Intergenic
1099855152 12:88155410-88155432 TAACTTTACCATTCAGGCTTTGG - Intronic
1101285773 12:103310570-103310592 GGCCTTTACAAGGCTGGCATAGG - Intronic
1102188810 12:110970380-110970402 AGCCTTCACCAGGCTGGCTTGGG - Intergenic
1103658065 12:122490302-122490324 TGGCTAAACCAGTCAGGCTTCGG + Intronic
1106027946 13:25973128-25973150 TGCCTTTGCCAGGAAGGCAGTGG + Intronic
1106468421 13:30033429-30033451 AGCCTTTGCCAGGCTGCCTTTGG - Intergenic
1117830666 14:59746553-59746575 TGTCTTCACCAGGCAGGGGTGGG - Intronic
1119469066 14:74882210-74882232 TGCCTTCTCCAGGCAGCCTGCGG + Intronic
1119857431 14:77910964-77910986 GGCCTCTACCAGGCAGGCCTAGG + Intronic
1120190539 14:81436159-81436181 TGGCTCGACCAGGCAGGCTCGGG + Intronic
1120679399 14:87462149-87462171 TTCCTTTCCCAAGAAGGCTTAGG - Intergenic
1122939867 14:104976452-104976474 TGCCTTTCCCAGCCTGGATTTGG - Intronic
1123116837 14:105898772-105898794 AGTCTTTCCCAGGCAGGCCTGGG - Intergenic
1124796900 15:32790389-32790411 TACATGTACCAGGTAGGCTTTGG - Intronic
1125530931 15:40412928-40412950 TTCCTTTACCAGGCCCCCTTGGG + Intronic
1126089323 15:45037513-45037535 TGCCTTTAGCAGGGAGGGTGGGG + Intronic
1127795288 15:62432923-62432945 AGCCCTTGCCAGGCAGGCATGGG + Intronic
1128107455 15:65055229-65055251 TGGCTTTGGCAGGCAGGTTTGGG - Exonic
1128160225 15:65418733-65418755 TGTCATTACCAGGCAGGCTTGGG - Intronic
1129708458 15:77808033-77808055 AGCCTTACCCATGCAGGCTTGGG + Intronic
1129966615 15:79741937-79741959 TGGCTTAAGCAGGCAGGATTGGG + Intergenic
1130948969 15:88570814-88570836 TGCCTTTACCATGCAATTTTGGG + Intergenic
1132177557 15:99727495-99727517 TCACTTCACCAGGCAGGCCTTGG - Exonic
1140102741 16:71932555-71932577 TGCCTTAACCTGGCAGGCGGAGG - Intronic
1140507403 16:75482420-75482442 TGCCTGTACTAGGGAGGCTGAGG + Intronic
1141170606 16:81688344-81688366 TTCCTTACCCAGGCAGGCGTTGG + Intronic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1141681515 16:85546954-85546976 CACATTTACCAGCCAGGCTTTGG - Intergenic
1141893794 16:86945520-86945542 TGCCTCTCCCAAGGAGGCTTGGG - Intergenic
1143695365 17:8611283-8611305 TGCTTTGGGCAGGCAGGCTTAGG - Intronic
1144044851 17:11446114-11446136 TGCCTTTAACAAGCATGCTGCGG - Intronic
1144342098 17:14318378-14318400 TGGCTCAACCAGGCAGGGTTGGG + Intronic
1145411709 17:22671314-22671336 CGCATTCACCAGGCAGGCTCAGG - Intergenic
1147342809 17:39764697-39764719 CTCCTTGATCAGGCAGGCTTCGG - Intergenic
1151317173 17:73330131-73330153 TGCATTTGCCAGCCAGGCCTGGG + Intergenic
1153459502 18:5318091-5318113 GGCCTTTGCCAGGTAGGCATGGG - Intergenic
1155353657 18:24930153-24930175 TGCCGTTGCTATGCAGGCTTTGG - Intergenic
1158023467 18:52869863-52869885 CGCCTTTACCCCCCAGGCTTGGG - Intronic
1158029271 18:52942828-52942850 TGCCTTTTCCAAGGAGGGTTTGG + Intronic
1158662483 18:59401060-59401082 TGCATTTCCCAGGCTGGTTTTGG + Intergenic
1161268709 19:3377483-3377505 TGCCTTGACCAGGCTGGGCTGGG - Intronic
1162268133 19:9592877-9592899 TGGCTTTTCCAGGGAGGGTTAGG + Intergenic
1162362326 19:10227549-10227571 AGCCAGTCCCAGGCAGGCTTGGG + Intronic
1162785368 19:13031589-13031611 TGCGTGTACCTGGCAGGCTTTGG + Intronic
1163474199 19:17515626-17515648 TGAGTTTCCCAGGCAGCCTTAGG + Intronic
1165123456 19:33578376-33578398 TCCCTTTCCCAGGCAGGCCAAGG + Intergenic
925161377 2:1686303-1686325 TGCCTTTAGCACCCAGGGTTAGG - Intronic
925260701 2:2526025-2526047 TTCTGTTACCAGGCAGGATTTGG - Intergenic
926628219 2:15112593-15112615 GGCCATAACCAGGCATGCTTTGG + Intergenic
928556829 2:32435196-32435218 TGCTTGTACCAGGCAGCCTAGGG + Intronic
930896147 2:56448867-56448889 TGCCTTTATGAGGCAGGCCCAGG - Intergenic
931080384 2:58762488-58762510 TGCCTCTGCCAAGCAAGCTTGGG - Intergenic
931894491 2:66713934-66713956 TGAGTTTAGCAGGCAGGCTTAGG - Intergenic
932001859 2:67892691-67892713 TGCCTTTATCAGCCAGCATTAGG + Intergenic
935875635 2:107504125-107504147 TGCCTTTAACAGTCTGTCTTAGG + Intergenic
936659715 2:114529114-114529136 TGCCCCTACCTGCCAGGCTTTGG + Intronic
937330147 2:121021509-121021531 TGCCTTTTCCATACAGTCTTAGG + Intergenic
939554635 2:143659678-143659700 TGCCCTTCCTAGGCAGGCATGGG + Intronic
942460061 2:176162505-176162527 AGCCTTAACCGGGCTGGCTTTGG - Intronic
944907362 2:204275966-204275988 TCCCTTTATCAAACAGGCTTTGG + Intergenic
945028634 2:205643105-205643127 TGCTTCTTCCAGGGAGGCTTGGG + Intergenic
945831486 2:214792058-214792080 TGCATGTACCAGGGAGGCTGAGG + Intronic
945951171 2:216040376-216040398 TGCCTGTACTTGGGAGGCTTAGG - Intronic
946062868 2:216959734-216959756 TGTGTTTACCAGGGAGTCTTGGG + Intergenic
947838312 2:233190606-233190628 TGCCCAGACCAGGCAGGCTGTGG + Intronic
948558392 2:238834068-238834090 AGCCTGGAGCAGGCAGGCTTCGG + Intergenic
948852858 2:240716863-240716885 TGCCTGTCCCTAGCAGGCTTGGG + Exonic
1170882218 20:20306725-20306747 TGCCCTTTCCAGGCAGGCAGAGG + Intronic
1171542977 20:25978614-25978636 TGCATTCACCAAGCAGGCTCGGG - Intergenic
1173638373 20:44581022-44581044 TTCCTTTCCCAGGCTGGCTGCGG + Intronic
1175445052 20:59014245-59014267 TTCCTGTACCAGGCAGACTCTGG - Intergenic
1175524084 20:59621607-59621629 GGCCTTTCCCAGGCAGGCACTGG + Intronic
1175533517 20:59690845-59690867 GGCCTTTGGCAGGGAGGCTTTGG - Intronic
1178746732 21:35258835-35258857 TGCCTTTAGCAGGCTGCCTTGGG + Intronic
1178954047 21:37007187-37007209 TGCCTTTGCAAGGCTGGCTTAGG - Intronic
1181756355 22:25027799-25027821 TGACCTCACCCGGCAGGCTTGGG - Intronic
1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG + Intergenic
1182843339 22:33410011-33410033 TGTCTTTATAATGCAGGCTTTGG + Intronic
1183210805 22:36450000-36450022 TTCCCTTGCCAGGCTGGCTTCGG - Intergenic
1184110223 22:42389827-42389849 GGCCTTCTCCAGGCAGGCTGAGG + Intronic
1185074087 22:48673860-48673882 TGCATTTCCCAGGCAGAGTTAGG - Intronic
949208666 3:1471843-1471865 TGCCTTTCCCAGTCAGGCAATGG - Intergenic
951244539 3:20325270-20325292 TGCCTTTACCATTCATACTTTGG + Intergenic
953604888 3:44405589-44405611 AGCCTTGACCACCCAGGCTTAGG - Intronic
954633927 3:52061336-52061358 TGCCTTCTCCAAGCAGCCTTGGG - Intergenic
955639828 3:61070280-61070302 TGGCATTAAAAGGCAGGCTTCGG + Intronic
956702328 3:71969286-71969308 TACCTTGCCCAGGCAGCCTTGGG + Intergenic
959151714 3:102616160-102616182 AGACTTTACCTGTCAGGCTTTGG + Intergenic
961497493 3:127304989-127305011 TCCCTTTGGCAGGCAGGCTTTGG + Intergenic
961650832 3:128415970-128415992 TGCCAGGACCTGGCAGGCTTGGG - Intergenic
962847044 3:139282030-139282052 TGCCTATAGCAGGCAGGTCTGGG + Intronic
964633482 3:158837102-158837124 TGCATTTAACAGGCAGGCTAAGG - Intergenic
965761201 3:172078851-172078873 TTCCTTTAGCAGGCTGCCTTGGG - Intronic
966427139 3:179791818-179791840 TGCCTGGACCTGGGAGGCTTTGG + Intergenic
966817681 3:183902641-183902663 TGCCTGTATCAGGAAAGCTTTGG - Intergenic
969557143 4:7919261-7919283 TGCATTTGCTAGCCAGGCTTCGG - Intronic
969875722 4:10134292-10134314 TCCCTTTCCCAGGCAGGTTCAGG - Intergenic
970958745 4:21847336-21847358 TGGCTTTACCACGTATGCTTGGG - Intronic
971159449 4:24119044-24119066 TTCCTTTATCAGGCAGTCATTGG + Intergenic
971409992 4:26360258-26360280 TGGCTTTTCCAGGCAGGATAGGG - Intronic
972734836 4:41830492-41830514 TGCCTTTAACAGGGAGGAGTGGG - Intergenic
978247269 4:106588941-106588963 TGTCTTTGCCAAGCAGGGTTTGG + Intergenic
981324178 4:143427520-143427542 TTTTTTTACCAGTCAGGCTTTGG - Intronic
986707805 5:10465922-10465944 TGCCCTTCCCAGGGAGTCTTAGG - Intronic
991419342 5:66425718-66425740 TGCCTTTTCCAGGAAGCCTCTGG - Intergenic
991501931 5:67285828-67285850 TGTCTGAACCAGGCAGGCTGAGG - Intergenic
994174136 5:96692501-96692523 TGCCTGTACCCAGCATGCTTTGG + Intronic
999124313 5:149235761-149235783 TGTCTGTACCAGGCAGGCTCTGG + Intronic
1001953844 5:175834554-175834576 TGCATTTCCCAGGCTGGCCTAGG - Intronic
1002329224 5:178429976-178429998 TTCCTTGTCCAGGCAGGCTCTGG + Intronic
1004525609 6:16404588-16404610 AGACTTTACCAGGCAGACTCTGG - Intronic
1004660508 6:17706014-17706036 GGGCTTTCCCAGGCAGGCTCTGG - Intronic
1007260966 6:40562775-40562797 TGCATGTACCATGGAGGCTTAGG - Intronic
1007339524 6:41181728-41181750 TGTCTTTGCCAGGCAGGGTGTGG - Intergenic
1007772254 6:44201322-44201344 TGCCTATACCTGGCTGGCTCTGG + Intergenic
1007814722 6:44513442-44513464 TGCCTTTCCCATGCATGGTTTGG + Intergenic
1008360168 6:50607975-50607997 TGCTTTAACCAGCCAGGCTCTGG - Intergenic
1009806748 6:68608880-68608902 TGCCTTTAGCAAGCAGGTTGTGG - Intergenic
1011190371 6:84721085-84721107 TGCCTTCCCCAGCTAGGCTTAGG + Intronic
1011636216 6:89376211-89376233 TGCCTTTACCTGGTAGACTCTGG - Intronic
1011984481 6:93425816-93425838 AGCTTTTAACAAGCAGGCTTTGG + Intergenic
1013094233 6:106929816-106929838 TGCCTTTCCCACTCAGACTTTGG - Intergenic
1016580419 6:145623457-145623479 TGACTATTCCAGGCAGGCTCTGG - Intronic
1016715452 6:147222553-147222575 TTCCTTTACTTGGAAGGCTTGGG + Intronic
1017520927 6:155201599-155201621 TTCCTTCGCCAGGCAGGCTATGG - Intronic
1017722540 6:157253878-157253900 TGCCCTTTCCAGGCAGGCTCTGG - Intergenic
1020439788 7:8205213-8205235 TGCCTTTTCCTGGCAGGGCTTGG + Intronic
1020601796 7:10284453-10284475 TGCCATTACTAGCCTGGCTTCGG + Intergenic
1020945188 7:14596391-14596413 TTCTGTTACCAGGCAGGCTCTGG + Intronic
1021612935 7:22475612-22475634 TGTGTTTACCATGCAGGCTGGGG - Intronic
1023573023 7:41592253-41592275 TGGCTTGTCCAGGCAGGGTTGGG - Intergenic
1024422786 7:49188886-49188908 TGCCTTTGCCATGCAATCTTTGG - Intergenic
1024857298 7:53796506-53796528 TGCCTTTACCTGACTGGATTAGG - Intergenic
1027978571 7:85187462-85187484 GGCCTTGACAAGGCAGGCATAGG + Intergenic
1029821275 7:103149612-103149634 TTCCTTTACCAAGATGGCTTCGG - Intergenic
1030135086 7:106238961-106238983 TTCCTTCCCCAGGCAGGCTAGGG + Intergenic
1032169729 7:129574652-129574674 TCACTTTACCAGGAAGTCTTGGG - Intergenic
1032976505 7:137230254-137230276 TGCCTTTACCAAGAAGAATTTGG - Intronic
1037366662 8:18129398-18129420 TGCAGTGACCATGCAGGCTTAGG + Intergenic
1037691751 8:21186565-21186587 GGCCTTTATAAGGCAGACTTGGG + Intergenic
1038424912 8:27458776-27458798 TGCATGGACCAGGCTGGCTTAGG - Exonic
1043380438 8:79696620-79696642 TGCCTTTCCTAGGGAGGCTCTGG - Intergenic
1043875668 8:85483624-85483646 TGCCTTGACCATGGAGTCTTTGG + Intergenic
1045267291 8:100630547-100630569 TGCCTATAGGAGGCAAGCTTTGG - Intronic
1047205877 8:122802742-122802764 TCACTTTACCAGCCAGGCGTTGG - Intronic
1048232082 8:132652233-132652255 TGGCTCTGCCAGGCAGGCTGAGG + Intronic
1049564123 8:143329081-143329103 TTCCCTTCCCAGGCAGGCTGTGG - Intronic
1050545156 9:6703564-6703586 TGCTTGAACCAGGCCGGCTTTGG - Intergenic
1050907351 9:11021723-11021745 TGCCTTTACCAATGAGTCTTAGG - Intergenic
1051691191 9:19714346-19714368 TTTTTTTACAAGGCAGGCTTGGG - Intronic
1055729411 9:79265172-79265194 TGCCTCTGCCAGGCAGCCTGTGG + Intergenic
1060024719 9:120161491-120161513 TGCCTTTGCCAGGCATTCTCTGG - Intergenic
1060325117 9:122606978-122607000 TGTCATTCCCAGGCATGCTTGGG + Intergenic
1061890105 9:133614826-133614848 TGCCATTGTTAGGCAGGCTTTGG - Intergenic
1062276956 9:135735823-135735845 TGCCTCTACCGAGCTGGCTTCGG + Intronic
1186540343 X:10393698-10393720 CCCCTTTACCTGGCAAGCTTTGG + Intergenic
1188808734 X:34624857-34624879 TTCCTATACAAGGTAGGCTTGGG - Intergenic
1189821869 X:44876515-44876537 TTCCTTTACTGGGCAGGTTTAGG + Intronic
1195482235 X:105359016-105359038 TTCCTTCATCAGGCAGTCTTTGG + Intronic
1196189366 X:112778966-112778988 TCCCTTTAGCAGGTAGGTTTTGG - Intronic
1199298120 X:146182293-146182315 TGCCTTTATCAAAGAGGCTTAGG - Intergenic
1199871495 X:151902437-151902459 TGCTATTGCCTGGCAGGCTTGGG - Intergenic
1202182407 Y:22150791-22150813 TGCATTTGTGAGGCAGGCTTGGG + Intergenic
1202208953 Y:22435611-22435633 TGCATTTGTGAGGCAGGCTTGGG - Intergenic