ID: 912431762

View in Genome Browser
Species Human (GRCh38)
Location 1:109631753-109631775
Sequence GACAGGACGGAGAAGGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912431762_912431766 -2 Left 912431762 1:109631753-109631775 CCAGCAGCCTTCTCCGTCCTGTC 0: 1
1: 0
2: 2
3: 20
4: 243
Right 912431766 1:109631774-109631796 TCCCCAGCCCACGTGCTCCTTGG 0: 1
1: 0
2: 6
3: 23
4: 257
912431762_912431775 24 Left 912431762 1:109631753-109631775 CCAGCAGCCTTCTCCGTCCTGTC 0: 1
1: 0
2: 2
3: 20
4: 243
Right 912431775 1:109631800-109631822 TCAGCTTCCTGTGCCTCTGTGGG 0: 1
1: 0
2: 7
3: 36
4: 322
912431762_912431776 29 Left 912431762 1:109631753-109631775 CCAGCAGCCTTCTCCGTCCTGTC 0: 1
1: 0
2: 2
3: 20
4: 243
Right 912431776 1:109631805-109631827 TTCCTGTGCCTCTGTGGGAGAGG 0: 1
1: 0
2: 7
3: 29
4: 303
912431762_912431774 23 Left 912431762 1:109631753-109631775 CCAGCAGCCTTCTCCGTCCTGTC 0: 1
1: 0
2: 2
3: 20
4: 243
Right 912431774 1:109631799-109631821 GTCAGCTTCCTGTGCCTCTGTGG 0: 1
1: 0
2: 4
3: 30
4: 343
912431762_912431777 30 Left 912431762 1:109631753-109631775 CCAGCAGCCTTCTCCGTCCTGTC 0: 1
1: 0
2: 2
3: 20
4: 243
Right 912431777 1:109631806-109631828 TCCTGTGCCTCTGTGGGAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 323
912431762_912431768 -1 Left 912431762 1:109631753-109631775 CCAGCAGCCTTCTCCGTCCTGTC 0: 1
1: 0
2: 2
3: 20
4: 243
Right 912431768 1:109631775-109631797 CCCCAGCCCACGTGCTCCTTGGG 0: 1
1: 0
2: 3
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912431762 Original CRISPR GACAGGACGGAGAAGGCTGC TGG (reversed) Exonic
900320528 1:2081383-2081405 GGCAGGAGGGGGCAGGCTGCAGG + Intronic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
900980665 1:6044377-6044399 GACTTCACGGAGAAGGCAGCAGG + Intronic
901063081 1:6482449-6482471 GACAGGAGGGAGGAGGAGGCCGG + Intronic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902538997 1:17139064-17139086 GGCAGGGAGAAGAAGGCTGCTGG + Intergenic
902782843 1:18715956-18715978 AACAGGATGGAAAAGGCTGATGG - Intronic
904790582 1:33017402-33017424 GAAAGGAGAGAGCAGGCTGCTGG + Intronic
905347008 1:37318150-37318172 GACACGACGCAGACGGCTCCGGG - Intergenic
906200528 1:43957335-43957357 GACAGGTCTGGGAAGGCTGAGGG - Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906833389 1:49058473-49058495 CACATGACTGGGAAGGCTGCAGG - Intronic
908842458 1:68293736-68293758 GGCAGGAAGGATAAGGCTGCAGG - Intergenic
912431762 1:109631753-109631775 GACAGGACGGAGAAGGCTGCTGG - Exonic
913255269 1:116947423-116947445 GACAGGATGGAGTAGGCTAAAGG - Intronic
913713578 1:121511535-121511557 GACAGGACAGAGAATGGAGCAGG + Intergenic
914386185 1:147172288-147172310 GCCAGGAGGGAGAGGGCTCCAGG - Intronic
917667465 1:177239170-177239192 GACAGGCCTCAGAAGGCTGGAGG + Intronic
923897769 1:238291990-238292012 GACAGGAAGGGTAAGGCTTCGGG - Intergenic
1063198447 10:3764737-3764759 AACAGGACAGAAGAGGCTGCTGG + Intergenic
1069632308 10:69904427-69904449 GAGAGGCCAGGGAAGGCTGCTGG - Intronic
1069897293 10:71687610-71687632 GACAGGTTGCAGGAGGCTGCAGG - Intronic
1070728059 10:78805473-78805495 GACAGTCCTGATAAGGCTGCAGG + Intergenic
1076935404 10:133565456-133565478 GACAGGGCTGAGAAGGCCGGAGG - Exonic
1078895165 11:15591391-15591413 GAGAGGACGGGGGAGGCTGGTGG + Intergenic
1079100483 11:17538654-17538676 GGCAGGGTGGAGAAGGCTGGAGG - Intronic
1082073514 11:47958571-47958593 GGCAGGAAGTAAAAGGCTGCTGG + Intergenic
1083151772 11:60796060-60796082 GACAGGACAGAGAAGGCCTGGGG + Intronic
1083301371 11:61741134-61741156 GACAGGACAGAGGAGGCTGGGGG - Intronic
1084411397 11:69008248-69008270 GAAAGGTCGGAGAGGACTGCCGG - Intronic
1084494548 11:69496449-69496471 GAAAGCACGGATAATGCTGCCGG - Intergenic
1085126739 11:74007146-74007168 GACAGGCCAGAGAAGGCTGATGG + Intronic
1085618882 11:78022728-78022750 GGCAGGCTGGAGAGGGCTGCAGG + Intronic
1087281663 11:96217613-96217635 GACAGGACAGAGAAGCTTGTAGG + Intronic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090410752 11:126508065-126508087 GAAAGGGAGGAGAAGGCTGATGG - Intronic
1090902260 11:131043455-131043477 GACAGGAGCAAGATGGCTGCAGG - Intergenic
1091781813 12:3218649-3218671 GAAAGGAAGGAGAAGGCACCAGG + Intronic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1094063576 12:26340572-26340594 GAAAGCACCGTGAAGGCTGCAGG + Intronic
1095984688 12:47991476-47991498 GTCAAGGCTGAGAAGGCTGCTGG + Intronic
1096230636 12:49895029-49895051 GGCAGGACGGAGAGAGCTGAGGG + Intronic
1097152946 12:56993164-56993186 GACAGGAAGCAGAAGGTTGGTGG + Intergenic
1098894045 12:76037400-76037422 GAAAGGACGGAGACAGCTGATGG - Exonic
1103711807 12:122918247-122918269 GACAGGAAGGCGAGGGCTCCTGG - Intergenic
1103737401 12:123069438-123069460 GACAGGACAGGGATTGCTGCAGG + Intronic
1104463044 12:128970441-128970463 GGCTGGAAGGAGGAGGCTGCTGG - Intronic
1104596316 12:130122477-130122499 GACGGGGCGCAGAAGGCTTCAGG + Intergenic
1104612464 12:130240970-130240992 GACAGGAAGTAGGAGGCAGCCGG - Intergenic
1104805525 12:131586975-131586997 GACAGGAGGCAGAAGACTCCTGG + Intergenic
1105523476 13:21152733-21152755 GGCAGGACGGAGAAGCAAGCTGG + Intergenic
1106183369 13:27386951-27386973 GACTGGAGGGAGGAGGCAGCTGG + Intergenic
1107054389 13:36087689-36087711 GAGAGGAGGGAGAAGCCTCCAGG - Intronic
1107646190 13:42496559-42496581 GCCAGGAGGGAGAAGCCAGCAGG - Intergenic
1113596619 13:111538308-111538330 AACAGGACGGGCAAGGTTGCAGG + Intergenic
1114426578 14:22628923-22628945 GAAAGGAGGAAGAAGCCTGCAGG - Intergenic
1116451505 14:45071777-45071799 GACATGACGGAAAAGCTTGCTGG + Exonic
1119198306 14:72733589-72733611 GAGAGGACGCAGCAGGCTGATGG - Intronic
1119406423 14:74402359-74402381 GAAGAGATGGAGAAGGCTGCCGG + Intergenic
1119703102 14:76768425-76768447 GACAGGAAGGAGAAGACCGACGG + Intronic
1119944343 14:78676054-78676076 GAAGGGAGGGAGAAGGCTGGAGG - Intronic
1121010348 14:90516729-90516751 GATAGGCCAGAGAAGGCAGCTGG + Intergenic
1122906801 14:104805383-104805405 GTCAGGACTGGGAAGGCGGCAGG - Intergenic
1124995109 15:34716264-34716286 GACAGGGCAGAGATGGCTGGAGG - Intergenic
1125004277 15:34799901-34799923 GACATGATGGTGAGGGCTGCAGG + Intergenic
1126133304 15:45365548-45365570 GACAGAAAGTAGGAGGCTGCAGG + Intronic
1126221702 15:46221744-46221766 GACAGGACAGAGGGAGCTGCGGG - Intergenic
1128065889 15:64764182-64764204 CACAGCACCAAGAAGGCTGCAGG - Intronic
1128343952 15:66842301-66842323 GGCAGGAAGGAGAGCGCTGCGGG + Intergenic
1128752835 15:70161328-70161350 GCCAGGAAGGAGGAGCCTGCAGG - Intergenic
1129688664 15:77700859-77700881 GACAGGAAGGGAGAGGCTGCGGG - Intronic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1137720788 16:50626182-50626204 GGCAGGAAGGAGAGAGCTGCAGG - Intronic
1140724098 16:77796768-77796790 GCCAGCACGGAGTAGGATGCTGG + Intronic
1141185700 16:81785558-81785580 GACAGGATAGAGAAGGATGTTGG + Intronic
1142222630 16:88863177-88863199 GACGGGACACAGAAGGCGGCTGG - Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142849427 17:2697101-2697123 GACAGGAAGAAAAAGGCGGCCGG + Intronic
1143100605 17:4502735-4502757 GGCATGAAGGAGAAGGCAGCTGG - Intronic
1143762756 17:9116818-9116840 GACAGGAAGGAGAAAGGTGGAGG + Intronic
1145742890 17:27291082-27291104 CACAGGACAGAGTAAGCTGCAGG - Intergenic
1146471113 17:33125829-33125851 GACAGGAAAGATAAGGCTGTAGG - Intronic
1146833285 17:36088950-36088972 GACAGGAAGAAGGAGGCAGCGGG - Intronic
1146847807 17:36195565-36195587 GACAGGAAGAAGGAGGCAGCAGG - Intronic
1147160826 17:38568635-38568657 GACTGGAAGGAGAGGCCTGCTGG + Intronic
1147304468 17:39553741-39553763 GGAAAGAGGGAGAAGGCTGCTGG + Intronic
1147844260 17:43393837-43393859 GGCAGGCAGGAGAGGGCTGCAGG - Intergenic
1148124521 17:45229978-45230000 GAAAGGAAGGAGAGGGCTGGGGG - Intronic
1148432229 17:47650850-47650872 GATAGGAAGGAGAAGCCGGCCGG - Intronic
1148759936 17:49994409-49994431 GAGAGGAAGGGGAAGGCTGTGGG - Intronic
1151460579 17:74251962-74251984 AACAGGGCGGAGGAGGTTGCAGG - Intronic
1151553613 17:74835728-74835750 AACAGGACAGAGAGGGATGCGGG + Intronic
1152234855 17:79133218-79133240 GAGAAGACAGAGGAGGCTGCAGG + Intronic
1152357573 17:79814252-79814274 GAAAGGACCGAGAGGGCTGGGGG - Intergenic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1152617074 17:81342928-81342950 GGAAGGACGGAGAAGGGTGAGGG - Intergenic
1153633618 18:7095484-7095506 GACAGGAAGGGGAGGGCTCCTGG - Intronic
1154412677 18:14149833-14149855 GAGAGGACAGAGACGGCTGCGGG + Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155725990 18:29083951-29083973 GACAGGAAAGAGGAGGCTGGTGG + Intergenic
1156403171 18:36759074-36759096 GACAGGACGGAAAAGACAGAAGG - Intronic
1156481441 18:37439037-37439059 ATCAGGACTGAGGAGGCTGCTGG - Intronic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1157413516 18:47483387-47483409 GAGAGGACAGAAAAGGCTTCGGG - Intergenic
1157516398 18:48314777-48314799 GACAGCTGGGAGAAGGGTGCAGG + Intronic
1159193560 18:65081702-65081724 GACAGTATGCAGAAAGCTGCTGG + Intergenic
1160149377 18:76387674-76387696 GACAGGAAGGAGAACACGGCTGG + Intronic
1162147609 19:8622415-8622437 GACAGCAGGGAGACGGCTCCAGG - Intergenic
1163044123 19:14626684-14626706 GACAGGGAAGAGAAGGCAGCTGG + Intronic
1163124313 19:15236526-15236548 GACAGGATGGAGTAGGGTGGAGG + Exonic
1163294154 19:16401471-16401493 GGCAGCACGGAGAGAGCTGCTGG + Intronic
1163413752 19:17172942-17172964 GAGAGGGCCGAAAAGGCTGCAGG + Exonic
1163463503 19:17453429-17453451 GACAGGAAGAAGGAGGCTGGGGG - Intronic
1163830645 19:19545672-19545694 GCCAGCATGGAGAAGGCAGCTGG - Exonic
1165492891 19:36135362-36135384 GACAGAAGGGAGCAGGCTGTGGG + Intergenic
1167383969 19:49153442-49153464 GACAGGAGAGAGGAGGCTGGAGG - Exonic
1168502061 19:56901016-56901038 GAAATGGCGGAGAAGGCTGGAGG + Intergenic
926238549 2:11068015-11068037 GCCAGGATGGAGGATGCTGCAGG + Intergenic
926644946 2:15280374-15280396 GGGAGAAGGGAGAAGGCTGCCGG + Intronic
926851190 2:17199260-17199282 GACTGGCTGGAGAAAGCTGCAGG + Intergenic
927649587 2:24904003-24904025 GACATGGTGAAGAAGGCTGCTGG - Intronic
927787100 2:25981835-25981857 AGCAGGAAGGAGGAGGCTGCTGG - Exonic
930265197 2:49191496-49191518 GACAGGACCAAGAAGGATGCTGG - Intergenic
931682980 2:64768206-64768228 GACCGGACGGGGGAGGCAGCCGG - Intergenic
934529300 2:95075157-95075179 GGCAGGTGGGTGAAGGCTGCTGG + Intergenic
934921612 2:98348536-98348558 GGCGGGACGGAGAAGGGTTCTGG - Intronic
935046744 2:99489850-99489872 GCAAGGCCGGAGAAGGCCGCCGG - Exonic
935431064 2:102976262-102976284 GACAGGGCAAAGAAGGCAGCAGG + Intergenic
938797466 2:134730502-134730524 GACAGGACGGAGCAGGCCGCTGG - Intergenic
939844652 2:147228736-147228758 GACAGGATAGAGAAGGATGAAGG - Intergenic
941281979 2:163563487-163563509 GACGGGATGGAGCAGGCTGGTGG - Intergenic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
948132486 2:235610855-235610877 GACAAGAATGAGAAGGCTGTGGG - Intronic
948200609 2:236127435-236127457 GAAAGGAGGGAGAAGGCAGCGGG + Exonic
948883695 2:240872815-240872837 GACAGGCAGGAGAAGGCAACTGG + Intronic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168923977 20:1564928-1564950 AGCAGGACTGGGAAGGCTGCAGG + Exonic
1169076638 20:2764053-2764075 GACAGGGTGGGGAAGGCGGCTGG - Intergenic
1170119438 20:12895615-12895637 GACAGGGAAGAGAAGGCAGCTGG - Intergenic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170570273 20:17628633-17628655 GGCTGGAAGGAGAAGGCTGGTGG - Intronic
1171271795 20:23823882-23823904 GAGAAGACAGAGAAGGCTGCAGG - Exonic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172762388 20:37331839-37331861 TCCAGGAATGAGAAGGCTGCAGG + Intergenic
1172989078 20:39018513-39018535 TACAAGCAGGAGAAGGCTGCAGG + Intronic
1173521785 20:43705374-43705396 GAGAGGACGGCGAAGGTTGGGGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174794508 20:53510930-53510952 GGCATGAGGGGGAAGGCTGCTGG - Intergenic
1175698847 20:61123141-61123163 GCCAGGAGGGAGAAGCCAGCAGG + Intergenic
1176139187 20:63537691-63537713 GGCAGGAAGGTGAGGGCTGCAGG + Intergenic
1176182514 20:63757618-63757640 GAAAGGAAGGAGAAAGCTGGAGG - Intronic
1176309630 21:5142748-5142770 CACAGGACTGAGAAAGCTGCCGG + Intronic
1176375692 21:6085960-6085982 GAGGGGACGGAGAAGGCCCCAGG + Intergenic
1176860329 21:14008422-14008444 GAGAGGACAGAGACGGCTGCGGG - Intergenic
1178268028 21:31162962-31162984 GAGAGGACGGAAGAGGCTCCAGG - Intronic
1179566803 21:42253990-42254012 GGCAGGAAGGAGACAGCTGCTGG + Intronic
1179682124 21:43030018-43030040 GACAGCACAGAGGAGGATGCGGG + Exonic
1179747782 21:43452284-43452306 GAGGGGACGGAGAAGGCCCCAGG - Intergenic
1179780015 21:43693515-43693537 GCCAGGACGCAGCAGCCTGCGGG - Exonic
1179847428 21:44119285-44119307 CACAGGACTGAGAAAGCTGCCGG - Intronic
1180064162 21:45404696-45404718 GACGGGACGGAGGAGGAAGCCGG - Intergenic
1182037973 22:27214247-27214269 GAGGGGACGGAGGAGGCAGCCGG - Intergenic
1183086461 22:35490197-35490219 GACAGGACAGAGCAGACGGCGGG - Intergenic
1183487879 22:38099106-38099128 GGCAGGACAGGAAAGGCTGCTGG + Intronic
1184266012 22:43346489-43346511 GGCAGGACGGAGTAGGCAGTTGG - Intergenic
1185338722 22:50282359-50282381 GACGGGAGGGCGGAGGCTGCAGG - Intronic
1185366906 22:50441001-50441023 GCCAGGACAGAGGAGGCTGTCGG + Exonic
1185409905 22:50676379-50676401 GACGGGACAGTGCAGGCTGCGGG + Intergenic
950106334 3:10391449-10391471 GACAGGATGGAAAAAGATGCAGG + Intronic
952253775 3:31678278-31678300 GACAGGAAGGACAAGGGTGCAGG + Intronic
954806268 3:53222713-53222735 GAGAGGAGGGTGAAGGCTGTTGG - Intergenic
955020827 3:55119641-55119663 GACATGAAGGACAAGGCTGCTGG - Intergenic
955542514 3:59992859-59992881 GACAGGACTGAAAATGCTTCTGG + Intronic
955671768 3:61409830-61409852 GACAGGAAGGGGAGGGCTGTCGG + Intergenic
956659023 3:71581794-71581816 GCCAGGACAGAGAGGGCAGCGGG + Intronic
961550364 3:127667470-127667492 TTCAGGAGGGAGAAGGCTGCTGG + Intronic
962482785 3:135811856-135811878 GCCAGGACTCAGAAGGCAGCAGG + Intergenic
964724416 3:159799528-159799550 CACAAGACGGACAAGCCTGCTGG + Intronic
964819463 3:160755015-160755037 CTCGGGAGGGAGAAGGCTGCTGG + Intergenic
965055325 3:163705659-163705681 CAAAGGAGGGAGAAGGCTGATGG + Intergenic
965332707 3:167396452-167396474 GACATGAGGCAGAAGTCTGCCGG + Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
967865605 3:194187467-194187489 GACAGGAGGGAAAGGGCTGAAGG + Intergenic
967933062 3:194704537-194704559 GACATGAGGATGAAGGCTGCTGG + Intergenic
967942509 3:194777052-194777074 CACTGGAGGGAGAGGGCTGCGGG + Intergenic
969036064 4:4254880-4254902 GACAAGACTGACAAGGCTGCAGG - Intergenic
970386112 4:15558461-15558483 GAGAGGATGGAGAAGGGTCCTGG - Intronic
973809642 4:54557505-54557527 GACAGGACGCAGAATGGGGCTGG - Intergenic
985165781 4:187092666-187092688 GACAGGAGGGAGAATGTTGCAGG - Intergenic
985702880 5:1384148-1384170 GACAGGACACAGAGGGCTTCTGG - Intergenic
985784425 5:1886584-1886606 GAGAGGAGGGAGAGGGCCGCGGG - Intronic
986067174 5:4245959-4245981 GACAGGGCAGAGAAGGCTTGGGG - Intergenic
986472737 5:8092182-8092204 GACAAGATGGAGAAGGCAGATGG + Intergenic
992037947 5:72799587-72799609 GTCAGGAGAGAGAAGGCTGGAGG + Intergenic
992078938 5:73216281-73216303 GCCAGGACGGCGCAGGCAGCTGG + Intergenic
992151943 5:73913607-73913629 GACAGGAAGAAGCAGGCTCCAGG + Intronic
997076888 5:130689552-130689574 GAGTGGACGGAGAGGGCTGGTGG - Intergenic
997299046 5:132789088-132789110 GAGAGACCGGAGCAGGCTGCTGG - Intronic
997398338 5:133582199-133582221 GCCAGGACTGAGAAGCCTCCTGG + Intronic
997952708 5:138254519-138254541 GGAATGAGGGAGAAGGCTGCAGG - Intronic
998992466 5:147833000-147833022 GACAAGAAGGATAAGGGTGCTGG + Intergenic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
999444487 5:151628364-151628386 GGCAGGAAGGAGAGGGCTGTGGG + Intergenic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
1001635333 5:173206052-173206074 CACAGGCCCCAGAAGGCTGCAGG + Intergenic
1001788509 5:174434732-174434754 GACAGGACGCAGTTGGCTGATGG - Intergenic
1002293039 5:178212573-178212595 GACAGGTCACACAAGGCTGCTGG - Intronic
1005092369 6:22071046-22071068 GACAGGCTGGATAATGCTGCAGG - Intergenic
1006948237 6:37799927-37799949 GAGAGGGTGGAGGAGGCTGCTGG + Intergenic
1007280903 6:40711616-40711638 GACAGAAAGGAGCAGTCTGCAGG + Intergenic
1007370927 6:41426810-41426832 GGCAGGGCGGAGAAAGCTGGGGG + Intergenic
1007393141 6:41561999-41562021 GACAGGATGGGGAAGGGTGCTGG - Intronic
1007923824 6:45635016-45635038 GGCAGGACACAGAAGGCTGGTGG + Intronic
1013251867 6:108342273-108342295 GACAGGACGGAGAAGGCATCAGG + Intronic
1015447108 6:133319020-133319042 GACAGCACGGAGCTGCCTGCTGG - Intronic
1017716676 6:157218071-157218093 GACAGGACGGAGAGGGCGGGTGG + Intergenic
1019524241 7:1473587-1473609 TGCAGGAAGGAGATGGCTGCTGG + Exonic
1020149043 7:5667511-5667533 TGCAGGATGGAGAAGGCTGGGGG - Intronic
1020350136 7:7210468-7210490 GACAGAAGGGAGAAGGCAGAAGG + Intronic
1021909191 7:25367146-25367168 GACAGGAAGTAGAAGGAAGCGGG + Intergenic
1023616963 7:42029601-42029623 GACAGGAGGCAAAAGGATGCAGG - Intronic
1023785631 7:43705318-43705340 CACTGGCAGGAGAAGGCTGCAGG + Intronic
1028501128 7:91520146-91520168 TACAGAACTGAGAGGGCTGCTGG + Intergenic
1029545215 7:101206911-101206933 GAGAGGAGGGAAGAGGCTGCAGG + Intronic
1030900806 7:115120929-115120951 GGCAGGCAGGACAAGGCTGCAGG - Intergenic
1031689038 7:124765671-124765693 GACGGGGCGAAGCAGGCTGCTGG + Intergenic
1032021784 7:128410475-128410497 AACAGAACAGACAAGGCTGCGGG + Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1033319012 7:140322777-140322799 GACAGGAGGCAGAAGGGTGAGGG + Intronic
1033329220 7:140404233-140404255 ACCAGGAAGGCGAAGGCTGCGGG + Intronic
1034878938 7:154749171-154749193 GACAGGAGGGAGAGGGATGGCGG + Intronic
1034878950 7:154749223-154749245 GACAGGAGGGAGAGGGATGGAGG + Intronic
1034878962 7:154749275-154749297 GACAGGAGGGAGAGGGATGGCGG + Intronic
1034878990 7:154749429-154749451 GACAGGAGGGAGAGGGATGGCGG + Intronic
1035254761 7:157619148-157619170 GACAGAGCCCAGAAGGCTGCAGG + Intronic
1037216988 8:16467099-16467121 GACAGGACAGAAATGGCTGGTGG + Intronic
1037788986 8:21919966-21919988 GAGGGGACGGAGAAGGCCCCCGG - Intronic
1038401001 8:27284451-27284473 GACGGGACTGAGAAGACTCCGGG + Intergenic
1038423058 8:27445947-27445969 GCCCGGACTGAGGAGGCTGCTGG + Intronic
1038495500 8:27999333-27999355 GACAGGATGGAGGAGGCTAGTGG - Intergenic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1043988605 8:86724034-86724056 GACCGGAGGGAGGAGGCTGAGGG + Intronic
1048581908 8:135735821-135735843 GAAAGCACAGGGAAGGCTGCTGG - Intergenic
1050507767 9:6365183-6365205 AAAAGGAAGGAGAGGGCTGCAGG + Intergenic
1053144503 9:35703372-35703394 GAGAGGGCTGAGAAGGCTGGAGG + Intronic
1053222074 9:36320585-36320607 GGCAGGAGGGAGCAGGCTGGGGG - Intergenic
1055489747 9:76792480-76792502 GAGAGGAATGAGAGGGCTGCAGG + Intronic
1056211963 9:84373230-84373252 GAGAGGACCAAGAAGGCTGTGGG - Intergenic
1057804503 9:98210774-98210796 GGCCGGTCTGAGAAGGCTGCAGG - Exonic
1060220965 9:121763907-121763929 GACAGGATGGGGAAGGCGACAGG - Intronic
1060968472 9:127724622-127724644 GAGAGGACGGAGACTGCGGCGGG + Intronic
1061170046 9:128947404-128947426 GAACGGAGGGAGAAGGTTGCTGG - Exonic
1061715632 9:132517158-132517180 GGGAGGAGGGAGAAGGCTGGAGG - Intronic
1185477089 X:421853-421875 GTCTGGACAGAGAAGGCTCCGGG - Intergenic
1186146167 X:6626316-6626338 GGCAGGACAGAGAGGGATGCTGG - Intergenic
1186363836 X:8871194-8871216 GAGAGGATGGAGAAGGGTGGAGG + Intergenic
1186761708 X:12729911-12729933 GCCAGGGCAGAGAAGGCTGAAGG - Intergenic
1188585390 X:31768308-31768330 GACAGGAGGGAGAAAGGTGGAGG - Intronic
1190305562 X:49079772-49079794 GTCAGGCCGGTGAAGGCGGCAGG - Exonic
1190469367 X:50762312-50762334 GACAGCACAGAGTAGGCTGAAGG - Intronic
1192450276 X:71240491-71240513 CACAGGGCAGAGAAGGCAGCTGG + Exonic
1193863253 X:86697061-86697083 GACAGGAGGCTTAAGGCTGCTGG - Intronic
1198146715 X:133864585-133864607 TTCAGGACAGACAAGGCTGCTGG - Intronic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1200357138 X:155563547-155563569 GAAAGGATGGGGAAGACTGCTGG + Intronic