ID: 912435131

View in Genome Browser
Species Human (GRCh38)
Location 1:109656382-109656404
Sequence CAGTGTCATGGACATGATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912435131_912435145 25 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435145 1:109656430-109656452 GTGAGGGTCCGCTGCACTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 96
912435131_912435141 8 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435141 1:109656413-109656435 GGACATCCGCGGGGTGAGTGAGG 0: 1
1: 1
2: 1
3: 7
4: 85
912435131_912435140 -1 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435140 1:109656404-109656426 GGGGTACTGGGACATCCGCGGGG 0: 2
1: 2
2: 0
3: 5
4: 41
912435131_912435138 -3 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435138 1:109656402-109656424 CTGGGGTACTGGGACATCCGCGG 0: 3
1: 2
2: 2
3: 11
4: 94
912435131_912435139 -2 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435139 1:109656403-109656425 TGGGGTACTGGGACATCCGCGGG 0: 2
1: 2
2: 2
3: 9
4: 73
912435131_912435146 30 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435146 1:109656435-109656457 GGTCCGCTGCACTGTGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 87
912435131_912435142 9 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435142 1:109656414-109656436 GACATCCGCGGGGTGAGTGAGGG 0: 1
1: 1
2: 0
3: 8
4: 56
912435131_912435144 24 Left 912435131 1:109656382-109656404 CCAGCATCATGTCCATGACACTG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 912435144 1:109656429-109656451 AGTGAGGGTCCGCTGCACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912435131 Original CRISPR CAGTGTCATGGACATGATGC TGG (reversed) Exonic
900466848 1:2829932-2829954 CAGAGTCATGGACAGGATGATGG + Intergenic
902744227 1:18462731-18462753 CAGGGACATGGAGATGAAGCTGG + Intergenic
906237848 1:44222556-44222578 CAGCGTCATGGACATGGGCCAGG + Intronic
910103671 1:83606678-83606700 CAGTCTCATGGAAGTGATGTGGG - Intergenic
910652385 1:89583319-89583341 CAGTGTCCTGGACAAGAAGGAGG + Exonic
911165781 1:94723415-94723437 CAGTGTCCTGAACATGAAGCAGG - Intergenic
912435131 1:109656382-109656404 CAGTGTCATGGACATGATGCTGG - Exonic
912436831 1:109668108-109668130 CAGTGTCATGGGCATGGTGCTGG - Exonic
912439531 1:109687866-109687888 CAGTATCATGGGCATGGTGCTGG - Exonic
912442840 1:109712305-109712327 CAGAGTCATGGGCATGGTGCTGG - Exonic
915152326 1:153843962-153843984 GAGTTTCCAGGACATGATGCAGG + Intronic
920539825 1:206769933-206769955 AAGTGTGATGGACATGGAGCTGG - Intronic
923147610 1:231209149-231209171 CGTGGTCAAGGACATGATGCTGG + Exonic
923261171 1:232269389-232269411 TACTGTCCTGGAGATGATGCTGG + Intergenic
923386407 1:233469697-233469719 TAGTATCATGGACATGATTCAGG - Intergenic
923515998 1:234698534-234698556 CATTGTCCTGGAGATGATGAAGG - Intergenic
924199198 1:241641373-241641395 CAGTGTCCAGGACAGGCTGCAGG - Intronic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1064141511 10:12794656-12794678 CAGTGTCATGAAATTGATGTGGG - Intronic
1065598388 10:27341162-27341184 CACTGTCACGGACATCAAGCCGG + Intergenic
1066492390 10:35906407-35906429 CAGTCACATGGCCAGGATGCAGG - Intergenic
1073001123 10:100286761-100286783 CTGTGTCATAGACCTGAGGCTGG - Intergenic
1079242624 11:18731495-18731517 CAATGCCATGGAGATGATGAGGG - Intronic
1080859169 11:36138327-36138349 CAGTGCCTGGCACATGATGCGGG + Intronic
1082179115 11:49097523-49097545 CAGTGTCATGGACATGGACATGG - Intergenic
1084519536 11:69655077-69655099 CCGTGTCAGGGCCATGATCCGGG + Intronic
1091794327 12:3288732-3288754 CAGTGGGATGGAGATGAAGCCGG + Intergenic
1092721411 12:11444625-11444647 CAGTGTCTTGGACAGGATAGAGG - Intronic
1097501758 12:60411885-60411907 CACAGTGATGGACATGATGTAGG - Intergenic
1101634434 12:106526552-106526574 GAGTCTCATGGATATAATGCTGG - Intronic
1104558048 12:129819899-129819921 CAGTGTCCTGGAGCTGAGGCTGG + Intronic
1108539121 13:51420525-51420547 AAATGTCATTGAAATGATGCAGG + Intronic
1111707539 13:91769624-91769646 CAGGGTGATGCAGATGATGCTGG + Intronic
1113492097 13:110700205-110700227 CAGTGTCAAGGACATGAGACAGG + Intronic
1116561216 14:46381727-46381749 CAGTGACATGGACCAAATGCAGG - Intergenic
1119807397 14:77491175-77491197 CAGTGTCATGAACATGGTGGGGG - Intronic
1120886363 14:89455051-89455073 CAGTGTAATGGACACAATGCAGG + Intronic
1122561546 14:102618555-102618577 CATTGGCATGGGCATGATGACGG - Intronic
1124658933 15:31529561-31529583 CAATGACATGGAGATGAAGCAGG + Intronic
1125039640 15:35170126-35170148 CAGTGTCATTTACATGAAGTTGG + Intergenic
1128322770 15:66704328-66704350 CAGTTTCAGGGACATGATGTAGG + Intronic
1129394630 15:75237229-75237251 CAGTGTCCAGGACAGGATGGGGG + Intergenic
1135990657 16:27216763-27216785 AAGTGACATGGACAGGACGCAGG - Intronic
1136011037 16:27363528-27363550 CAGTGTCATGGCCAGGAGGATGG + Exonic
1136183368 16:28570235-28570257 CACTGGCAGGGACATGTTGCTGG - Intronic
1139924569 16:70479065-70479087 CAGTGTCATGGTAAAGAAGCCGG - Intronic
1140821204 16:78665029-78665051 TAGTGTAATGAACAGGATGCAGG - Intronic
1141251710 16:82364649-82364671 CAGTGTCCTGGACAGGATCCCGG - Intergenic
1142880197 17:2877944-2877966 CAGTGGCTTGGAGATGATGGTGG + Intronic
1144400563 17:14895093-14895115 CAGTCTAATGGACAACATGCAGG + Intergenic
1144743089 17:17595374-17595396 CACACTCATGGACATGCTGCTGG + Intergenic
1144847881 17:18229481-18229503 GAGTGTCATGGTCATCTTGCGGG + Intronic
1146257164 17:31398393-31398415 CAGTGTCTTGGGAATGACGCTGG - Intronic
1149427216 17:56566670-56566692 CAGTGTAATCAACCTGATGCTGG - Intergenic
1149884150 17:60324401-60324423 CAGTGTCTTCCACATGAGGCAGG + Intronic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1157586168 18:48802662-48802684 CAGTGACATGAACATCAGGCAGG + Intronic
1158311736 18:56166656-56166678 CTCAGACATGGACATGATGCAGG + Intergenic
1161459700 19:4389435-4389457 CGGTGACATGGACAGGAGGCAGG + Intronic
1162403373 19:10459473-10459495 GAATATCATGTACATGATGCAGG - Exonic
1162600501 19:11664891-11664913 CAGTTGCTTTGACATGATGCTGG - Intergenic
1164740761 19:30573886-30573908 CACTGTCATGGCCATCATGTTGG - Intronic
1164964794 19:32473463-32473485 CACAGTGATGGACATAATGCTGG - Intronic
1166267728 19:41695462-41695484 CAGTGTCCTGCACATGCAGCCGG - Intronic
925694172 2:6557322-6557344 AAGTGTCATGGTAAAGATGCTGG + Intergenic
926432078 2:12798003-12798025 CAATGTCATGGAAATAATGAAGG + Intergenic
926816050 2:16798440-16798462 AAGTTTCAGGGACATGATGGTGG + Intergenic
928310352 2:30204605-30204627 CAGTGTGGTGGGCATGATGGAGG - Intergenic
928487304 2:31745681-31745703 CATATTCATGGACATGCTGCAGG + Intergenic
931231548 2:60379378-60379400 CAGTGTCAGAGCCATGATTCAGG + Intergenic
932901281 2:75703599-75703621 TACTGTCAGGGACATGATGAAGG + Intronic
934219824 2:90072582-90072604 CTGTGTCATGGGTATGATCCAGG - Intergenic
934545820 2:95215081-95215103 CAGTGTGAATGACCTGATGCTGG - Exonic
936483907 2:112910433-112910455 CTGTGTTATTGACATGCTGCTGG + Intergenic
936600178 2:113888417-113888439 AAGTGTCAAGGACCTGAGGCAGG - Intergenic
937150960 2:119685301-119685323 CAGAGTCATGGCGCTGATGCTGG + Intronic
938959727 2:136330253-136330275 TGGTGTCATGGGCATGGTGCTGG - Intergenic
944860146 2:203808188-203808210 CAGTGACTTGGAAATGATTCAGG + Intergenic
945072456 2:206005083-206005105 CAGTTTCATGGACTTCATGACGG - Exonic
946414282 2:219531838-219531860 CAGTGGCCTGGAGATCATGCTGG + Exonic
947482127 2:230510372-230510394 CAGAGTCTTGGACACCATGCAGG - Intronic
948077351 2:235175121-235175143 CAGTGTCATCAACATGGAGCCGG + Intergenic
1169967753 20:11236483-11236505 CAGTGTGGTAAACATGATGCAGG - Intergenic
1170941855 20:20854621-20854643 CAGGGTCATGGCCAGGATGCTGG - Intergenic
1173855058 20:46244949-46244971 CAGGGTCATGCACAGGTTGCTGG - Intronic
1174079413 20:47960460-47960482 CTGAGTCATGGACATGAGTCTGG + Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1178264841 21:31133383-31133405 CAGTGTGATGCCCATGAAGCTGG + Intronic
1180824107 22:18851304-18851326 CAGTGTCAGGGAAATGATCATGG + Intronic
1181188631 22:21123244-21123266 CAGTGTCAGGGAAATGATCATGG - Intergenic
1181210570 22:21287249-21287271 CAGTGTCAGGGAAATGATCATGG + Intergenic
1181398942 22:22639642-22639664 CAGTGTCAGGGAAATGATCATGG - Intergenic
1181501671 22:23318988-23319010 CAGTGTCAGGGAAATGATCATGG - Intergenic
1181650479 22:24256417-24256439 CAGTGTCAGGGAAATGATCATGG + Intergenic
1181706901 22:24654321-24654343 CAGTGTCAGGGAAATGATCATGG - Intergenic
1182716395 22:32359128-32359150 CAGTGTCAGGGACATTATAGGGG - Intronic
1183760397 22:39811313-39811335 CAGTGGCCTGGACCTGCTGCAGG - Intronic
1184578919 22:45398850-45398872 CAGTGGCATAATCATGATGCAGG - Intronic
1184884806 22:47336392-47336414 GATTGTGATGGACATGATGGAGG - Intergenic
1203216378 22_KI270731v1_random:8181-8203 CAGTGTCAGGGAAATGATCATGG - Intergenic
1203274248 22_KI270734v1_random:77208-77230 CAGTGTCAGGGAAATGATCATGG + Intergenic
950342348 3:12258440-12258462 CAGTGTGATGGGCATGGTGCTGG + Intergenic
950423222 3:12910749-12910771 CAGTGTCAGGGACCTGCAGCTGG - Intronic
952047470 3:29340297-29340319 CAGTTTCATGCCCATGAAGCTGG + Intronic
952561709 3:34603309-34603331 AAGTGATATGGACAGGATGCAGG + Intergenic
953046460 3:39297657-39297679 CAGTGTTGTGGGCATGATGGAGG + Intergenic
953930034 3:47001276-47001298 CAGCCTCCTGGAGATGATGCTGG + Exonic
954116284 3:48468588-48468610 CAGAGCCAGGGACATGATGCAGG - Exonic
955227787 3:57075222-57075244 CAGTGTAATGGAGATGAAGCTGG - Exonic
958882564 3:99689410-99689432 CAGTATAATGGAAATAATGCTGG - Intronic
960230334 3:115219002-115219024 CTCTGTCAGGTACATGATGCTGG + Intergenic
964144050 3:153437075-153437097 CACAGTCATTGAAATGATGCAGG + Intergenic
964825676 3:160825014-160825036 CAGTGTCATAAATATGATGATGG + Intronic
965836326 3:172856997-172857019 GAGTGTCAAGGAAATGAAGCAGG + Intergenic
970667351 4:18353342-18353364 CATGGTCTTGGACATGATCCAGG + Intergenic
973031044 4:45339960-45339982 CAGTGTCAAAGAGATGATGATGG + Intergenic
973288701 4:48448207-48448229 CAGTGTCTTGGGCGTGATCCTGG + Intergenic
974445604 4:61976942-61976964 CAGTGTCATGGACATATAGGTGG + Intronic
975772731 4:77746026-77746048 TAGTGGCTTGGAAATGATGCTGG - Intronic
976365471 4:84228419-84228441 CAGTGCCAAGGACATCTTGCAGG + Intergenic
977419029 4:96774056-96774078 CAGTGTGGTGGACATGGTGTTGG + Intergenic
983288481 4:165770068-165770090 AAGTGGCATGGAAAAGATGCTGG + Intergenic
983577788 4:169276943-169276965 GATTCTCATGTACATGATGCTGG + Intergenic
988011144 5:25487803-25487825 TAGTGTCATAGACAGGATCCTGG - Intergenic
988526381 5:31990862-31990884 CAGTGTCATGGGCAGGGGGCTGG + Intronic
989566093 5:42902944-42902966 CAATGTGATTGACATGCTGCAGG + Intergenic
990791097 5:59480960-59480982 CAGTGTCATGCACATGAACTTGG + Intronic
993292478 5:86092421-86092443 CAGTGTTAGGGACATAGTGCTGG + Intergenic
994994635 5:107044385-107044407 CAGGGCCATGGACATGGTGCAGG - Intergenic
996341464 5:122443664-122443686 CAGTGTCAAGGACAAGAAGGAGG + Intronic
1001971207 5:175956436-175956458 CAGTGTCCTGGACGTGAAGATGG - Intronic
1002246235 5:177887341-177887363 CAGTGTCCTGGACGTGAAGATGG + Intergenic
1002429478 5:179194701-179194723 CAGTCTCAGTGACCTGATGCAGG + Intronic
1003673661 6:8182669-8182691 CTGTGTCATAGACATCAGGCTGG + Intergenic
1013534100 6:111047507-111047529 CAGTGTCACGGGCATGGTGCTGG + Intergenic
1014302555 6:119700672-119700694 CAGTGTCTATGACATGGTGCAGG - Intergenic
1016629392 6:146210629-146210651 CAGTGTCATGGGCAGGCTCCTGG - Intronic
1017950663 6:159132555-159132577 CAGATTCATGGACAGGATCCAGG + Intergenic
1019721365 7:2574112-2574134 CAGTGTGATGGTCACGGTGCTGG - Intronic
1020682722 7:11256778-11256800 CTGTGTTCTGGGCATGATGCTGG - Intergenic
1020941942 7:14550724-14550746 GATTGTCATGAACATGATGACGG + Intronic
1021835910 7:24674528-24674550 CAGGGTAATGAACATGCTGCTGG + Intronic
1023622386 7:42086805-42086827 CAGTGGGGAGGACATGATGCGGG - Intronic
1027216414 7:76186678-76186700 GAGTGTAATTGACATGAGGCTGG - Intergenic
1027917749 7:84347885-84347907 CAGAGTGATGGACATGTTTCAGG + Intronic
1027984017 7:85262066-85262088 CAGTAACATGGACATAATGATGG - Intergenic
1029202550 7:98848616-98848638 CAGGGTCATGTACATGATGAAGG + Exonic
1035070310 7:156139850-156139872 GAGTGTGATGGACATGAGGCTGG + Intergenic
1037733187 8:21546528-21546550 CAGAGTGATGGAGATGAGGCTGG - Intergenic
1038424240 8:27454204-27454226 CAATGTCATGGAGCTGGTGCGGG + Exonic
1038759661 8:30374842-30374864 CATAGTCATGTACAAGATGCTGG - Intergenic
1039355803 8:36814346-36814368 CAGTGTGAAGAACATGATGAAGG - Exonic
1039628597 8:39082704-39082726 AAGTGTCATGGACATGGGGTAGG + Exonic
1040306465 8:46214515-46214537 CCTTGTCATGGCCAAGATGCAGG + Intergenic
1042008385 8:64209339-64209361 GAGTTTCAAGGGCATGATGCTGG + Intergenic
1042601501 8:70503515-70503537 CAGTGATATGGACAGGAGGCAGG - Intergenic
1049396051 8:142401426-142401448 CACTGTCAGGGACATAAAGCAGG + Intronic
1049472509 8:142782762-142782784 CAGTCTCAGGGACATGACCCAGG - Intergenic
1050944871 9:11504065-11504087 CAGTTTAATTGACATGAGGCCGG + Intergenic
1052048764 9:23822841-23822863 CAGCTTCAAGGGCATGATGCAGG + Intronic
1058594247 9:106598354-106598376 TAGTGTCATGGAGATGGAGCTGG - Intergenic
1060055723 9:120411290-120411312 CTGTGTCATGGAAAGAATGCAGG - Intronic
1060931145 9:127490186-127490208 CAGTGTGCTGAACATGATGCAGG - Intronic
1062190000 9:135243050-135243072 CAGGGTCATGGCTAAGATGCCGG - Intergenic
1185623285 X:1466342-1466364 GAGCGTCACGGACCTGATGCTGG - Exonic
1188042262 X:25382546-25382568 CAGAGTTATGGACTTAATGCAGG + Intergenic
1188581183 X:31715889-31715911 CATGGTCATGGAGATGATGATGG + Intronic
1188583417 X:31743640-31743662 CGTTGTCATGGACATAATGATGG + Intronic
1190957314 X:55208259-55208281 CAGTTTAATAGACATGAGGCTGG + Intronic
1192758070 X:74066726-74066748 CAGAGCCAGAGACATGATGCAGG + Intergenic
1193010411 X:76669366-76669388 CTGTGTCATGGACATGAACAAGG + Intergenic
1199435972 X:147813064-147813086 CAGTGCCATGGACACGATAGAGG - Intergenic