ID: 912445546

View in Genome Browser
Species Human (GRCh38)
Location 1:109733369-109733391
Sequence GTACCAGGAGGTAGGATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912445546_912445553 -1 Left 912445546 1:109733369-109733391 CCCATGATCCTACCTCCTGGTAC 0: 1
1: 0
2: 6
3: 33
4: 266
Right 912445553 1:109733391-109733413 CTCATGCCCTTGAGTGTGGGTGG 0: 1
1: 0
2: 4
3: 44
4: 274
912445546_912445551 -5 Left 912445546 1:109733369-109733391 CCCATGATCCTACCTCCTGGTAC 0: 1
1: 0
2: 6
3: 33
4: 266
Right 912445551 1:109733387-109733409 GGTACTCATGCCCTTGAGTGTGG 0: 1
1: 0
2: 2
3: 14
4: 101
912445546_912445555 1 Left 912445546 1:109733369-109733391 CCCATGATCCTACCTCCTGGTAC 0: 1
1: 0
2: 6
3: 33
4: 266
Right 912445555 1:109733393-109733415 CATGCCCTTGAGTGTGGGTGGGG 0: 1
1: 1
2: 4
3: 44
4: 280
912445546_912445552 -4 Left 912445546 1:109733369-109733391 CCCATGATCCTACCTCCTGGTAC 0: 1
1: 0
2: 6
3: 33
4: 266
Right 912445552 1:109733388-109733410 GTACTCATGCCCTTGAGTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 98
912445546_912445557 5 Left 912445546 1:109733369-109733391 CCCATGATCCTACCTCCTGGTAC 0: 1
1: 0
2: 6
3: 33
4: 266
Right 912445557 1:109733397-109733419 CCCTTGAGTGTGGGTGGGGCCGG 0: 1
1: 1
2: 9
3: 57
4: 487
912445546_912445554 0 Left 912445546 1:109733369-109733391 CCCATGATCCTACCTCCTGGTAC 0: 1
1: 0
2: 6
3: 33
4: 266
Right 912445554 1:109733392-109733414 TCATGCCCTTGAGTGTGGGTGGG 0: 1
1: 0
2: 5
3: 71
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912445546 Original CRISPR GTACCAGGAGGTAGGATCAT GGG (reversed) Intronic
900837850 1:5019659-5019681 GTACTAGGAGGTAGGGCCTTTGG - Intergenic
901442070 1:9283929-9283951 GTATTAGGAGGTAGGAGCTTTGG + Intergenic
901822051 1:11836588-11836610 GTACCAGGAGGAAGGAGCACTGG + Intronic
902213120 1:14917767-14917789 ATACCAGGAGGCAGGATCATTGG - Intronic
903362899 1:22788154-22788176 ATGCCAGGAGGTGGGATCATGGG + Intronic
905424256 1:37870501-37870523 GTACTAGGAGGTAGGGCCTTTGG + Intronic
907271720 1:53295261-53295283 ATTCCAGGAGGAAGGATAATGGG + Intronic
907575439 1:55521849-55521871 GTACCAGGAGGCAGGACCACTGG - Intergenic
907928366 1:58975692-58975714 GTATCAGGAGGTGGGGTCTTTGG - Intergenic
907954479 1:59215104-59215126 GTATCAGGGGGTAGGAGCTTGGG - Intergenic
908682638 1:66679349-66679371 GTACTAGGAACTAGGGTCATAGG - Intronic
908702443 1:66916945-66916967 ATACCATGAAATAGGATCATAGG - Intronic
909354883 1:74697056-74697078 GTACTAGGAGGTGGGGTCTTTGG + Intergenic
909379829 1:74985707-74985729 GTATTTGGAGGTAGGATCTTTGG + Intergenic
911180199 1:94853698-94853720 GAAACAGGAGGTAAGATCATGGG + Intronic
911184416 1:94888851-94888873 TTCCCAGTAGCTAGGATCATAGG + Intronic
912271266 1:108211455-108211477 GTAACAGGAAATAAGATCATGGG + Intergenic
912445546 1:109733369-109733391 GTACCAGGAGGTAGGATCATGGG - Intronic
913355245 1:117913809-117913831 GTATTAGGAGGTAGGGTCTTTGG + Intronic
913402348 1:118449732-118449754 GTAGAAGGTGGTTGGATCATGGG + Intergenic
916523229 1:165584665-165584687 GTATTAGGAGGTAGGACCTTTGG + Intergenic
917052462 1:170939564-170939586 GTAGTAGGAGGAAGGATCACTGG + Intronic
918083077 1:181222208-181222230 GGCCCAGGAGGATGGATCATTGG + Intergenic
920275425 1:204800878-204800900 GTATCAGGAGGTGGGGTCTTCGG - Intergenic
920599231 1:207305773-207305795 GTGCCAGGAACTAGGACCATTGG - Intergenic
921905561 1:220492145-220492167 ATACCACGAGGCAGGATCATTGG - Intergenic
922849249 1:228718471-228718493 ATTCCAGGAGGCAGGATTATTGG + Intergenic
923257744 1:232235652-232235674 GTAGCAGGAGGTGGGGCCATCGG - Intergenic
924069220 1:240258557-240258579 GTACAAGGAGACAGGATCCTAGG - Intronic
924182485 1:241452972-241452994 GTAGCAGAAGGGAGGACCATGGG + Intergenic
1063481245 10:6378464-6378486 GTAGGAGGAGATTGGATCATGGG - Intergenic
1063543329 10:6956295-6956317 GTACCTTGAGTTAGGATCCTGGG - Intergenic
1064315438 10:14251101-14251123 CTACCAAGAGGTGGGGTCATTGG - Intronic
1064455041 10:15479773-15479795 GTACCAGGAGGGAAGAACCTTGG - Intergenic
1065282639 10:24155259-24155281 GTAACTGGAGATAGGATCAGGGG + Intronic
1065949859 10:30642008-30642030 GTAGGAGGTGGTTGGATCATGGG - Intergenic
1067689990 10:48495629-48495651 CTACCAGGAGGAAGGTTCACCGG - Intronic
1069976336 10:72216194-72216216 GTCCCTGCAGGTAGGATCCTGGG - Exonic
1070126882 10:73629662-73629684 GTACAAGTAGGTGGGATTATAGG + Intergenic
1070528834 10:77318510-77318532 ATACTAGAAGGTAGGATGATAGG - Intronic
1071513114 10:86279054-86279076 GTATCAGGAGGTGGGATCTTTGG + Intronic
1076982740 11:213488-213510 GCCCCAGGAGGTAGGATCAGAGG + Intronic
1078089033 11:8252434-8252456 GTGCCAGGAGGCAGGATCACTGG - Intronic
1078300554 11:10127017-10127039 TTACCAGGAGGTAGGGGCAAAGG + Intronic
1078861813 11:15255138-15255160 GTACCAAGTGGAATGATCATGGG - Intergenic
1079739475 11:24038537-24038559 GTAGGAGGTGATAGGATCATGGG - Intergenic
1081417252 11:42830958-42830980 GTACCAGAGGTTAGGAGCATGGG - Intergenic
1082101050 11:48173287-48173309 ATACCAGGCGGGAGGATTATTGG - Intergenic
1082832618 11:57630245-57630267 TTACTAGGAGGTAGGATCACTGG - Intergenic
1083354562 11:62056533-62056555 GTATCAGGAGGCAGGGCCATTGG + Intergenic
1087336200 11:96847863-96847885 GTACTAGGAGGTGGGGTCTTTGG + Intergenic
1088130933 11:106489910-106489932 GTATTAGGAGGTAGGGTCTTTGG - Intergenic
1088344270 11:108805030-108805052 GCACAAGGAGGCAGGATCCTGGG + Intronic
1090214762 11:124952129-124952151 GAACGTAGAGGTAGGATCATTGG - Intergenic
1090575157 11:128094438-128094460 GTAGCAGGAGTGGGGATCATGGG - Intergenic
1091914793 12:4263161-4263183 TTGCCAGGAGGTAGGATGTTTGG + Intergenic
1091967833 12:4760522-4760544 ACACCAGGAGGAGGGATCATGGG + Intronic
1093007749 12:14068795-14068817 ATACCAGGATGTGGGGTCATTGG - Intergenic
1093369420 12:18349213-18349235 ATACCAGGAGACAGAATCATTGG + Intronic
1093378020 12:18455274-18455296 ACACCAGTAGGTGGGATCATTGG + Intronic
1093394981 12:18670046-18670068 GTATTAGGAGGTAGGATCTTTGG - Intergenic
1094586765 12:31784190-31784212 CTACCAGGAGGAAGGATCATTGG - Intergenic
1096189933 12:49609837-49609859 GTCCCAGGAGGTAAGATGAGTGG - Intronic
1097591931 12:61585253-61585275 ATACCAGGAGGTAGGATGTAGGG + Intergenic
1098571947 12:71997742-71997764 GTACCATGAGGTAGGGACAGGGG + Intronic
1098800832 12:74955745-74955767 GTAGCAGGTGTTTGGATCATTGG + Intergenic
1099504711 12:83459177-83459199 ATACCAGGAGGTGGAATCACAGG + Intergenic
1099544216 12:83956118-83956140 GTGGAAGGTGGTAGGATCATGGG - Intergenic
1100241254 12:92712401-92712423 GTACCAGGAGATGTGTTCATTGG + Intergenic
1100593748 12:96053885-96053907 GTACCAGGAGGGGTGATCACTGG + Intergenic
1101219968 12:102628400-102628422 GGAGCAGGAAGTAGGATCATGGG - Intergenic
1101466038 12:104950268-104950290 GTAGGAGGTGGTTGGATCATGGG + Intronic
1102165112 12:110799791-110799813 ACACCAGGAGGTGGGATCTTGGG + Intergenic
1104110026 12:125696131-125696153 GTATTAGGAGGTTGGATCTTGGG - Intergenic
1104305175 12:127603640-127603662 ATATGAGGAGGTAGGGTCATTGG + Intergenic
1104313613 12:127676775-127676797 GTACTAGGAGGTGGAATCTTTGG + Intergenic
1105234549 13:18536638-18536660 GTACTAGGAGGTGGGGTCTTTGG - Intergenic
1105584251 13:21729441-21729463 GTTCCTGGTGCTAGGATCATGGG - Intergenic
1105588094 13:21763321-21763343 GTATAAGGTGGTAGGTTCATTGG - Intergenic
1108134941 13:47346019-47346041 GTATTAGGAGGTTGGATCTTTGG + Intergenic
1108242132 13:48475704-48475726 ATACCAGGAGGTGGGGTCATTGG + Intronic
1109119320 13:58434216-58434238 GTACCAGGAGGTAAAACCTTTGG + Intergenic
1109330460 13:60922888-60922910 GTGCCAGGTGGTAGGAATATAGG - Intergenic
1110817257 13:79875883-79875905 GTATTAGGAGGTAGGGTCCTTGG - Intergenic
1112625405 13:101098044-101098066 GAACAAGGAGGAAGGAGCATGGG - Intronic
1112646744 13:101341821-101341843 CTACCAGAAGGTAGGACCTTTGG + Intronic
1112924671 13:104659478-104659500 GTAGGAGGTGATAGGATCATAGG + Intergenic
1113829033 13:113280132-113280154 GTATCAGGAGGTAGGGCCTTTGG + Intergenic
1113895413 13:113761003-113761025 GTACCTGGGGGTAGGATTATGGG + Intronic
1114900512 14:27052081-27052103 GTAGGAGGAGATTGGATCATGGG - Intergenic
1115327793 14:32161683-32161705 TAACCATGAGCTAGGATCATTGG - Intergenic
1115423624 14:33227676-33227698 GTACTTGGAGGTGGAATCATTGG - Intronic
1116113360 14:40615320-40615342 GTATTAGGAGGTGGGATCTTTGG + Intergenic
1118607311 14:67513979-67514001 GTACCAGGAAGAGGGATCAAGGG - Intronic
1118759495 14:68871238-68871260 TTACCAGGAGGTAAGATTAATGG + Intergenic
1119147802 14:72332575-72332597 ATGCCAGGAGGCAGGATCTTGGG + Intronic
1119414846 14:74462999-74463021 ATACCAAGATGTCGGATCATGGG + Intergenic
1120710810 14:87791122-87791144 GTATTAGGAGGTAGGATCTTTGG + Intergenic
1121303528 14:92890428-92890450 GTATTAGGAGGTAGGGCCATTGG + Intergenic
1124373088 15:29114486-29114508 TCACAAGGAGGCAGGATCATTGG + Intronic
1125962686 15:43845348-43845370 GTATTAGGAGGTAGGACCTTTGG + Intronic
1126670089 15:51108196-51108218 GTACCAAAAGGCAGGATCAGAGG + Intergenic
1128346322 15:66854711-66854733 GTTCCAGGAGGCAGGAGCCTGGG + Intergenic
1128686001 15:69686077-69686099 CTAACAGGAGGGAGGATCTTTGG + Intergenic
1130102867 15:80906934-80906956 GGAACAGGAGGTGGGATCAAGGG + Intronic
1130973580 15:88755506-88755528 GTAGGAGGTGGTTGGATCATGGG - Intergenic
1132418233 15:101640221-101640243 GTATCAGGAGGTGGGACCTTTGG + Intronic
1133973589 16:10584254-10584276 ATACCAGGAGGCAGGCGCATGGG - Intergenic
1134367858 16:13595833-13595855 GTACTAGGAGGTGGGACCTTTGG + Intergenic
1134899910 16:17928139-17928161 GTATTAGGGGGTAGGACCATTGG - Intergenic
1135452947 16:22573879-22573901 CTCCCAGTAGCTAGGATCATAGG + Intergenic
1140032030 16:71346562-71346584 GTCCCAGGAGGTTGGACTATAGG - Intergenic
1140691405 16:77487878-77487900 GTACCAGAAGGTGGGATCATGGG + Intergenic
1140716734 16:77733461-77733483 GTATTAGGAGGTGGGATCTTTGG - Intronic
1140756050 16:78067775-78067797 ATACCAGGGGGTAGGGTCACTGG + Intergenic
1141212825 16:81996821-81996843 ATACCAGGAGGTGGTGTCATTGG - Exonic
1143731499 17:8885229-8885251 TTACCGGGAGGCAGGACCATGGG - Intronic
1143731546 17:8885360-8885382 GTACCGGGAGGCAGGGCCATGGG - Intronic
1144260478 17:13514646-13514668 GGACAAGGAGGGTGGATCATGGG + Intronic
1144310957 17:14013980-14014002 ATACCAGGAGTTGGGATCATGGG - Intergenic
1144820243 17:18067800-18067822 CTGCCATGAGGTAGGATCCTAGG + Exonic
1145019860 17:19421265-19421287 GTATCAGGAGGTGGGGTCTTTGG - Intergenic
1151106666 17:71623625-71623647 GTATTAGGAGGTAGGGTCTTTGG - Intergenic
1154514993 18:15153220-15153242 GTACTAGGAGGTGGGGTCTTTGG + Intergenic
1155350418 18:24900607-24900629 GTAGAAGGTGGTTGGATCATGGG - Intergenic
1155773219 18:29726079-29726101 GTAGGAGGAGTTTGGATCATGGG + Intergenic
1156088980 18:33442208-33442230 ATACCAAGGGGTAGGGTCATGGG - Intergenic
1156457687 18:37303914-37303936 GTCCCTGGGGGTAGCATCATAGG + Intronic
1157182481 18:45509984-45510006 CTAACAGGGGGTAGGATTATGGG - Intronic
1157696756 18:49729323-49729345 GTGCTAGGAGCTAGGATTATGGG - Intergenic
1158418637 18:57273002-57273024 GTATTAGAAGGTAGGATCTTTGG + Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1162712888 19:12609315-12609337 CTACCAGAAGGGTGGATCATGGG + Intronic
1163107966 19:15138046-15138068 GTACCAGGAGGTGGGATCACTGG + Intergenic
1163552241 19:17971932-17971954 GGACGAGGAGGAAGGATCACTGG + Intronic
1163691779 19:18742327-18742349 GGACCATGAGGAAGGAACATGGG + Intronic
1166067126 19:40366501-40366523 GTACCAGGAGGTAGGTGGATTGG + Exonic
1166389761 19:42402377-42402399 GTACCAAGAGACAGGATCAGTGG - Intronic
1167654195 19:50752810-50752832 GAGCCAGGAGGTAGGAGCTTGGG + Intergenic
1167655892 19:50763951-50763973 GAGCCAGGAGGTAGGAGCTTGGG + Intergenic
1168412538 19:56148623-56148645 GTGCCAGGAGGCAGGAGCAGAGG - Intronic
925584515 2:5450846-5450868 GTACTAGGAGGTGGGACCTTTGG - Intergenic
927181975 2:20453160-20453182 CTACCAGAAGGTGGGCTCATTGG + Intergenic
927409469 2:22807689-22807711 GTATCAGAAGGTAGAACCATTGG - Intergenic
928619166 2:33071460-33071482 CTACCAGGCAGTGGGATCATTGG + Intronic
929757523 2:44779627-44779649 GTACCTGGAGGTGGAACCATAGG - Intergenic
930831651 2:55750060-55750082 GTACTAGGAGGTAGGGCCTTTGG + Intergenic
931500035 2:62855437-62855459 GCAGCAGGAGGTAGGTTCCTGGG + Intronic
932185441 2:69691400-69691422 GTACCAGGGGCTAGGAGCAGTGG - Intronic
932916082 2:75859610-75859632 GTATTAAGAGGTAGGATCTTTGG + Intergenic
933966570 2:87434676-87434698 GTACCAAGAGGTAGGGATATTGG + Intergenic
934518132 2:95001571-95001593 GTACCAAGAGGAAGGTTCAGAGG + Intergenic
936327223 2:111515808-111515830 GTACCAAGAGGTAGGGATATTGG - Intergenic
936399306 2:112153705-112153727 GGACCAGGAGGTAGGGTCTGGGG + Intronic
937098213 2:119249319-119249341 GGACCAGGAGGGAGCATCAGGGG - Intronic
938515258 2:131998003-131998025 GTACTAGGAGGTGGGGTCTTTGG + Intergenic
938991723 2:136636483-136636505 ATACCAGGAGGCAGGATCATTGG + Intergenic
939668241 2:144977269-144977291 ATACCAAGAGGTAAGATCACTGG - Intergenic
940832948 2:158488624-158488646 ATTCCAGGAGGTGGGATCACTGG - Intronic
942225081 2:173807914-173807936 GTATTAGGAGGTGGGATCTTTGG - Intergenic
942832343 2:180251977-180251999 GTACTAGGAGGTAGGGCCTTTGG - Intergenic
945331799 2:208548470-208548492 ATACCAGGAGGTTGCATCACAGG + Intronic
945819799 2:214650176-214650198 GTACCAGGATTTTGGATCACTGG - Intergenic
946638674 2:221758930-221758952 GTAGCAGGTGTTTGGATCATGGG + Intergenic
947485216 2:230541748-230541770 GTACTAGGAGGTGGGACCTTTGG - Intronic
947577141 2:231284752-231284774 CTACCAGGAGGTGGAATCACTGG + Intronic
948154433 2:235770068-235770090 TTACTAGGAGGTGGGATTATAGG - Intronic
1169542340 20:6613681-6613703 CTACAAGGAGGTGGCATCATCGG + Intergenic
1170892049 20:20384291-20384313 TTACTAGGAGGTGGGATCTTTGG - Intergenic
1171126965 20:22610892-22610914 ATACCAGGAGGTGGGATAATTGG + Intergenic
1172780482 20:37433915-37433937 GGACCAGGAGGTAGGGTGGTGGG - Intergenic
1172913174 20:38425161-38425183 GTACCAGGAGGTAACATCACTGG + Intergenic
1173148314 20:40544447-40544469 ATATCAGAAGGTAGGATCACTGG - Intergenic
1173289074 20:41698636-41698658 AAACCAGGAGGCAGGATCATTGG - Intergenic
1173922757 20:46758396-46758418 GTCCCAGGAGGTGGGATTCTGGG - Intergenic
1174327888 20:49793887-49793909 ATACCAGGAAGTGGGATCACTGG + Intergenic
1176778537 21:13164924-13164946 GTACTAGGAGGTGGGGTCTTTGG - Intergenic
1177617084 21:23536987-23537009 GTGTCAGGAGGTAGGGTCACTGG + Intergenic
1177734951 21:25077285-25077307 GTATTAGGAGGAAGGATCTTTGG - Intergenic
1177781236 21:25624551-25624573 GTACCAGGAGATGGGACCTTAGG + Intergenic
1177976160 21:27853938-27853960 GTACTAGGAGGTGGGGTCTTTGG - Intergenic
1179030175 21:37713116-37713138 GTACAGGGAGGTAGAAACATGGG + Intronic
1179239327 21:39575123-39575145 GTATTAGGAGGTGGGACCATTGG - Intronic
1179877208 21:44275160-44275182 GTAGCAGGTGATCGGATCATGGG - Intergenic
949338733 3:3005771-3005793 GTATCAGGAGGTGGGGTCTTTGG - Intronic
951153047 3:19315238-19315260 GATCCAAGAGGTAGGATCACAGG + Intronic
955505216 3:59625885-59625907 GTATTTGGAGGTAGGATCTTTGG - Intergenic
958955021 3:100458001-100458023 AAACCAGGTGGGAGGATCATGGG - Intergenic
960454949 3:117859655-117859677 GTAACAGGAGTGAGGATCATGGG - Intergenic
961319965 3:126065987-126066009 GTACCAGGAGGCAGGGTCGGGGG - Intronic
962555683 3:136548811-136548833 GTAGGAGGTGGTTGGATCATGGG + Intronic
963318308 3:143784818-143784840 GTATTAGGAGGTAGGACCTTTGG + Intronic
963803164 3:149697523-149697545 GTGGGAGGAGGTTGGATCATGGG - Intronic
963842539 3:150122364-150122386 GTATTAGGAGGTAGGCTCTTTGG + Intergenic
964743538 3:159990367-159990389 GTACCAGAGGGGAGGATCAGAGG - Intronic
965485059 3:169268455-169268477 GTACAAGAAGATAGCATCATTGG - Intronic
966001063 3:174949137-174949159 GTAGTAGGAGGTAGGATCTTTGG - Intronic
969070457 4:4534005-4534027 GTACAAGGAGGTAGAAACTTAGG - Intronic
969665253 4:8553643-8553665 GCACCAGGAGCCAGGATCAGAGG - Intergenic
970558692 4:17261169-17261191 GTACCAGGAGGTGGGGCCTTTGG - Intergenic
971021794 4:22544558-22544580 GTACCAGGAGGCAGAATTATTGG + Intergenic
972236859 4:37145330-37145352 GTACCAAGAGGGAAGTTCATAGG - Intergenic
973310613 4:48705791-48705813 ATACCAGGAAGTATGGTCATAGG - Intronic
974554002 4:63419677-63419699 ATATTAGGAGGTAGGATCTTTGG - Intergenic
976428023 4:84928923-84928945 ATACCAGGAGGTAGGGTCATTGG - Intronic
976492183 4:85684110-85684132 GTACCCAGAAGTGGGATCATTGG + Intronic
976839810 4:89418881-89418903 GTATTAAGAGGTAGGATCGTTGG - Intergenic
977077467 4:92474176-92474198 GTACCAGGAGATAGGAGGGTAGG - Intronic
977518977 4:98056736-98056758 GTAGGAGGTGGTTGGATCATGGG + Intronic
979080177 4:116329007-116329029 GTATTAGGAGGTAGGGTCTTTGG - Intergenic
979450475 4:120864920-120864942 CTGCCAGGAGGTAGGATCACTGG + Intronic
981053205 4:140332122-140332144 GTAGCAGGCGGTTGGATCACGGG - Intronic
981675584 4:147339406-147339428 AGACCAGGAGGTAGGATCAAAGG + Intergenic
982340416 4:154292683-154292705 GTATCAGGAGGTATGAACATGGG - Intronic
982699103 4:158639499-158639521 GTACAAGGAGGTAGGGCCTTTGG + Intronic
982723889 4:158885222-158885244 GTAGGAGGAGTTTGGATCATGGG - Intronic
983366887 4:166802617-166802639 GTACCAGGAGGTGGGACCTGTGG - Intronic
983848858 4:172554360-172554382 CTACCAGGAGCTAGAATTATTGG + Intronic
986673924 5:10167487-10167509 GTATCAGGAGGTAGGGCCTTTGG - Intergenic
986688352 5:10293491-10293513 GTATCAGGAGGTCGGGTCTTTGG - Intronic
987000900 5:13658409-13658431 GTGCCTGGGGGTAGAATCATAGG - Intergenic
987428079 5:17796104-17796126 ATACCAAGACGCAGGATCATTGG - Intergenic
987597645 5:20021476-20021498 GTATGAGGAGATTGGATCATGGG + Intronic
988787951 5:34581345-34581367 CTACCAGGAGTTAGGACAATTGG - Intergenic
988879438 5:35484977-35484999 ATACCAGGAGGTGGGATTATTGG + Intergenic
989507860 5:42248090-42248112 GTAGGAGGAGATTGGATCATGGG - Intergenic
991098720 5:62767938-62767960 GTATTAGGAGGTAGGATCCATGG + Intergenic
991612606 5:68464816-68464838 GCAACAGGAGGTACCATCATGGG + Intergenic
992578102 5:78140623-78140645 GTATTAGGAGGTAGGACCTTTGG - Intronic
993526455 5:88971621-88971643 GTATTAGGAGGTAGGGTCTTTGG + Intergenic
995062067 5:107821973-107821995 ATACCAGAAGGCAGGGTCATTGG - Intergenic
995511880 5:112918728-112918750 GTGCCAGCAGGTAGGGTCAGTGG - Intronic
996151664 5:120044659-120044681 ATACCAGAAGGTGGGATCATTGG - Intergenic
997352461 5:133240795-133240817 TTCCCAGGAGGTAGCATCCTAGG - Intronic
998267563 5:140677518-140677540 GCCCCAGGATGTAGGCTCATGGG - Intronic
998669773 5:144340594-144340616 GTATTAGGAGGTAGGGTCTTTGG + Intronic
998860600 5:146439958-146439980 ATATCAGAAGGTGGGATCATTGG - Intergenic
1003126247 6:3358201-3358223 GTACCTGGAAGTAGAATCACTGG - Intronic
1003257353 6:4486162-4486184 CTATCAGGAGGGAGGATCATGGG + Intergenic
1004691747 6:17998159-17998181 GAAACAGAAGGTAGGATCATAGG - Intergenic
1005159533 6:22843131-22843153 GTACTTGGAGGTGGGATCTTTGG - Intergenic
1007149349 6:39672816-39672838 ATATCTGGAGGTAGGATCTTTGG - Intronic
1008265933 6:49426343-49426365 GTATTTGGAGGTAGGATCTTTGG - Intergenic
1008614801 6:53216370-53216392 GTACTAGGAGGTGGGGTCTTTGG + Intergenic
1008689208 6:53958765-53958787 GTATTAGGAGGTAGGATTTTGGG - Intronic
1008869968 6:56261408-56261430 GTATTAGGAGGTAGGGTCTTTGG + Intronic
1009902299 6:69822233-69822255 GTATCAGGAGGTGGGACCTTTGG + Intergenic
1011540659 6:88424456-88424478 GTAGGAGGAGTTTGGATCATGGG + Intergenic
1012564361 6:100628451-100628473 GTAGGAGGTGATAGGATCATGGG + Intronic
1013428486 6:110035522-110035544 GTACCAGGAGTTAGGAGCCAAGG - Intergenic
1013805254 6:113989521-113989543 GTATCAGGAGGTGGGGCCATTGG - Intronic
1014245412 6:119062693-119062715 TTACCATGAGGTGGGATCAGTGG - Intronic
1014566006 6:122948154-122948176 GTACCTGGTGATGGGATCATGGG - Intergenic
1016303892 6:142662731-142662753 GTAGGAGGAGATTGGATCATGGG - Intergenic
1016862840 6:148737917-148737939 TTTCTAGGAGGTAGGTTCATAGG + Intergenic
1021817307 7:24460231-24460253 GTAGGAGGGGGTTGGATCATGGG - Intergenic
1025250450 7:57348058-57348080 GTCCCAGGAGGTAACATCCTGGG - Intergenic
1027413876 7:77953029-77953051 GTACAAGGAAGAAAGATCATTGG - Intronic
1027490199 7:78814187-78814209 ACTCCAGGAGGTGGGATCATGGG - Intronic
1028954896 7:96677599-96677621 GTGCCTGGAGATAGGATCAAAGG + Intronic
1030657238 7:112181750-112181772 GTAACAGGAAGCAGGATCACAGG + Intronic
1030836317 7:114291337-114291359 GTACTAGGAGGTAGAACCTTTGG - Intronic
1032762433 7:134956382-134956404 GTATTAGGAGGTGGGATCTTTGG + Intronic
1032887936 7:136162521-136162543 GTACCAGGAGATATGATGTTGGG - Intergenic
1033889330 7:145990287-145990309 TTATTAGGAGGTAGGACCATTGG + Intergenic
1034634987 7:152560102-152560124 GGCCCAGGTGGTAGGATCACTGG + Intergenic
1034899042 7:154896182-154896204 GTACCAGGAGGGAGCACCAAGGG - Intergenic
1037960536 8:23094608-23094630 ATACCAGGAGAGAGGATCACTGG + Intronic
1041718317 8:60951984-60952006 GTACTAAGAGGTAGGGTCTTTGG - Intergenic
1043429047 8:80176762-80176784 GGCCAAGGAGGGAGGATCATTGG + Intronic
1043500048 8:80844469-80844491 GTATTAGGAGGTAGGACCTTTGG - Intronic
1044512286 8:93096315-93096337 ATACCAGGAAGCAGGATCACCGG + Intergenic
1046701347 8:117404363-117404385 GTACCACGAAGGAGGATCAAAGG + Intergenic
1046800612 8:118422697-118422719 GAGCCATGAGGCAGGATCATAGG + Intronic
1048020258 8:130531762-130531784 GTAGGAGGTGATAGGATCATGGG + Intergenic
1049502784 8:142976507-142976529 GTATCAGGAGGTGGGGTCTTTGG + Intergenic
1053088894 9:35254477-35254499 GTACTAGGAGGTAGGGCCTTTGG - Intronic
1055710104 9:79051399-79051421 TTACCAAGAGGTTGGATTATTGG + Intergenic
1055734132 9:79309710-79309732 GTACCATGAGGTTGGAGCAAAGG + Intergenic
1056077547 9:83057082-83057104 GGCCCAGGAGGAAGGATCAAAGG + Intronic
1056491507 9:87112511-87112533 GAACCAGAAGGTAGGGACATTGG - Intergenic
1056693825 9:88829776-88829798 GACCCAGGAGGAAGGCTCATGGG + Intergenic
1056853319 9:90103079-90103101 GTATCAGGAGGTGGGGTCTTTGG + Intergenic
1058378465 9:104352623-104352645 ATACCAGGAGGGAGGATCACTGG - Intergenic
1060669428 9:125456464-125456486 AAAGCAGAAGGTAGGATCATTGG - Intronic
1186489004 X:9956910-9956932 GTATTAGGAGGTGGGATCTTTGG - Intergenic
1187562427 X:20415220-20415242 ATCCCAGGAGGTGGCATCATAGG + Intergenic
1188216072 X:27478911-27478933 ATACCAGGAGAAAGGATCACTGG - Intergenic
1188812129 X:34663561-34663583 TGACCAGGAGGTAGGAATATGGG + Intergenic
1189032412 X:37464033-37464055 GTAGCAGGAGTGAGGAACATGGG + Intronic
1194163294 X:90482834-90482856 ACACCAGGAGGCAGGATCATTGG - Intergenic
1194626649 X:96233408-96233430 GTAGCAGGAGTGAGGACCATGGG - Intergenic
1194675206 X:96785846-96785868 GTATTAGGAGGTAGGAACTTTGG - Intronic
1194675949 X:96793725-96793747 GTATTAGGAGGTGGGATCTTTGG - Intronic
1195872785 X:109503329-109503351 GTACCAGGAGCAAGTACCATAGG + Intergenic
1196127866 X:112118622-112118644 ATACCAGGAGATGGGATCATGGG + Intergenic
1196500425 X:116374572-116374594 GTAGCAGGAGTTTGGCTCATGGG - Intergenic
1196802286 X:119554497-119554519 GTACCAGGGACAAGGATCATTGG - Intronic
1196822977 X:119718147-119718169 GTATTAGGAGGTAGGACCTTTGG - Intergenic
1197276620 X:124487145-124487167 TTATCAGGAGGTAGTCTCATAGG + Intronic
1197435840 X:126426872-126426894 GTATTAGGAGGTAGGACCTTTGG - Intergenic
1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG + Intergenic
1199331051 X:146559942-146559964 ATGCCAGGAGGTGGGATCTTTGG + Intergenic
1199371595 X:147056200-147056222 GTAGCAGGAGTGGGGATCATGGG + Intergenic
1200509564 Y:4060559-4060581 ACACCAGGAGGCAGGATCATTGG - Intergenic
1201990678 Y:20021489-20021511 GTAGCAGGTGATTGGATCATGGG + Intergenic