ID: 912449362

View in Genome Browser
Species Human (GRCh38)
Location 1:109759828-109759850
Sequence CATCAAGTGCTGCAGGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912449357_912449362 -9 Left 912449357 1:109759814-109759836 CCCTGCTTGCATGTCATCAAGTG 0: 1
1: 0
2: 1
3: 5
4: 101
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273
912449353_912449362 10 Left 912449353 1:109759795-109759817 CCCCTGGACTCTCTGACTCCCCT 0: 1
1: 0
2: 2
3: 37
4: 471
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273
912449352_912449362 17 Left 912449352 1:109759788-109759810 CCTCGGGCCCCTGGACTCTCTGA 0: 1
1: 0
2: 0
3: 16
4: 243
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273
912449358_912449362 -10 Left 912449358 1:109759815-109759837 CCTGCTTGCATGTCATCAAGTGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273
912449355_912449362 8 Left 912449355 1:109759797-109759819 CCTGGACTCTCTGACTCCCCTGC 0: 1
1: 0
2: 4
3: 41
4: 447
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273
912449356_912449362 -8 Left 912449356 1:109759813-109759835 CCCCTGCTTGCATGTCATCAAGT 0: 1
1: 0
2: 0
3: 8
4: 116
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273
912449354_912449362 9 Left 912449354 1:109759796-109759818 CCCTGGACTCTCTGACTCCCCTG 0: 1
1: 0
2: 2
3: 44
4: 402
Right 912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912449362 Original CRISPR CATCAAGTGCTGCAGGGAGA GGG Exonic
900372511 1:2338321-2338343 CAGCAAAAGCTGCTGGGAGAAGG - Intronic
900848307 1:5121332-5121354 CATCAAGACCTGCAGGGACCTGG + Intergenic
900942596 1:5810703-5810725 CACCTTGTGCTGCAGGGAGGGGG - Intergenic
902673847 1:17994575-17994597 CAATAAGTGGTGCAGGGAGGAGG + Intergenic
902799446 1:18820172-18820194 CCTCACGAGCTGCGGGGAGATGG - Intergenic
902973811 1:20074320-20074342 CATAAACTGTTGCAGGGAGGGGG + Intronic
903001325 1:20268109-20268131 CCTCAAAGGCTGCAGGGGGAGGG - Intergenic
903788642 1:25877576-25877598 CATCAAGTGCAGTAGTGAGGAGG - Intergenic
903946225 1:26965164-26965186 TATCAGGGGCTGGAGGGAGAGGG + Intergenic
904054424 1:27660667-27660689 CAACAAGTGTTCCAGGCAGAGGG + Intergenic
904075734 1:27840768-27840790 CATCATGTGTTACAGTGAGAAGG - Intronic
904392144 1:30193020-30193042 CCTCAGGTGCAGCTGGGAGAAGG - Intergenic
904454371 1:30638531-30638553 CAGCACATGCTGCAGGGACAAGG - Intergenic
905593509 1:39185817-39185839 CATGAAGAGATACAGGGAGATGG - Intronic
906104362 1:43283099-43283121 CAACAAGTGCTGCAGAGAAAGGG + Exonic
906264462 1:44417895-44417917 CTCCAAGTGCTGCAGAGCGACGG - Intronic
907805710 1:57817458-57817480 CTTCCAGAGCTGCAGGGGGATGG - Intronic
909209823 1:72808806-72808828 CATACTGTGCTGCTGGGAGATGG + Intergenic
909734727 1:78943196-78943218 CATCGAGTGCTCCAGGCAGTAGG + Intronic
911160657 1:94679827-94679849 CATCATGTTCTGCAAGGAGATGG + Intergenic
912251855 1:108020183-108020205 TATCAGGTGCTGCAGGATGATGG + Intergenic
912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG + Exonic
914977495 1:152379736-152379758 CTTTAAGTCCTGTAGGGAGAAGG + Intergenic
916788265 1:168102293-168102315 CAGTGAGTGCTTCAGGGAGAAGG - Intronic
917325648 1:173829288-173829310 CATTAGGTGCTGCTGGGGGAAGG + Intronic
917802998 1:178587241-178587263 CACCCAGAGCTGCAGAGAGAGGG - Intergenic
918229415 1:182514601-182514623 CTTCAAGTCCTGTAGAGAGAAGG + Intronic
918954696 1:191190837-191190859 CATAAACAGATGCAGGGAGAAGG + Intergenic
920813998 1:209313977-209313999 CATGAAGTCCTGCAGCAAGAAGG + Intergenic
922336718 1:224624155-224624177 CATCAAGTGCTGAGCTGAGAAGG - Intronic
922704632 1:227782720-227782742 CTTAAAGTGCTGAAAGGAGATGG - Intergenic
1064092496 10:12396723-12396745 CAACAGCTGCTGCGGGGAGAAGG - Intronic
1067049181 10:43002138-43002160 CATCAACTGCTCCAGGCAGGAGG - Intergenic
1068602277 10:58968534-58968556 CATCAAGTGCTCCCTGGGGAGGG + Intergenic
1069619887 10:69830608-69830630 CATCAAATTCAGCAGGGAGGAGG + Intronic
1069843239 10:71353123-71353145 CCTCAAGTGCTGCGCTGAGAAGG - Intronic
1070754304 10:78982116-78982138 CCTCACATGCTGCAGGGAGGTGG + Intergenic
1070997806 10:80801364-80801386 CATCAAATGCTGCAGTCAGCTGG - Intergenic
1072304356 10:94093197-94093219 AATAATGTACTGCAGGGAGATGG - Intronic
1073770294 10:106728356-106728378 CATCATCTGCTCCAGGGAAATGG + Intronic
1074423707 10:113331970-113331992 CTACGAGTGCTGCAGGGACAAGG + Intergenic
1074685198 10:115955529-115955551 CATATAGAGCTTCAGGGAGAAGG + Intergenic
1074893280 10:117753233-117753255 TACCAGGTGCTGGAGGGAGAGGG - Intergenic
1075441167 10:122480350-122480372 CAGGAAGCTCTGCAGGGAGAAGG + Intronic
1077102821 11:829733-829755 CAGCCAGGGCTGCAGGGAGGAGG + Intronic
1077233490 11:1469024-1469046 GGGCACGTGCTGCAGGGAGAGGG - Intergenic
1077403755 11:2372720-2372742 GTTCAAGTGCAGCAGTGAGAAGG - Intergenic
1079475631 11:20826281-20826303 CATCAAGGACTACAGGCAGAGGG - Intronic
1079669569 11:23150492-23150514 AACCAAGTACTGCTGGGAGAGGG - Intergenic
1079924889 11:26481650-26481672 CTTCAAGTATTGCATGGAGATGG + Intronic
1080530555 11:33171389-33171411 AGTCAAGTGCAGCAGTGAGAAGG + Intergenic
1080693568 11:34580929-34580951 CATAAAGTGCAGCAGGGACCGGG + Intergenic
1081330325 11:41792906-41792928 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1083210786 11:61184254-61184276 CATCAAGTGCAGCGGTGAGAGGG + Intergenic
1083303189 11:61749450-61749472 CAGCAAGGGCTGGAGGTAGAAGG - Intergenic
1083932790 11:65855147-65855169 CGTCAAGGGATGGAGGGAGAAGG + Exonic
1084230896 11:67751999-67752021 CATCAAATGCTCCAGAGAGGTGG + Intergenic
1086130064 11:83392298-83392320 GGTCAAGGGCTACAGGGAGAGGG - Intergenic
1088442732 11:109889429-109889451 CTTCAAGAGCTGAGGGGAGAGGG - Intergenic
1089133763 11:116233154-116233176 CACAAAGTTTTGCAGGGAGAGGG - Intergenic
1091380384 12:54390-54412 CATCAAGCCCTGCTGTGAGAAGG - Intergenic
1091726285 12:2848707-2848729 CATCAAATGGTCCAGGGAGGGGG + Intronic
1091740507 12:2958044-2958066 CATCCAGTCCTGCAAGGTGAAGG - Intergenic
1092569801 12:9709441-9709463 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1095504557 12:42880829-42880851 AATAAAGTGCTTCAGGAAGAAGG - Intergenic
1096524548 12:52202754-52202776 CATCATTTGATGCAGGGGGAGGG + Intergenic
1097728537 12:63101450-63101472 CCTCATGTGCTGCACCGAGAAGG + Intergenic
1098919034 12:76286070-76286092 TATCAACTGCTCCATGGAGATGG + Intergenic
1099051733 12:77789272-77789294 AACCAAGTGATGCAGGGAGGAGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099290210 12:80767542-80767564 CCTCAAATTCTTCAGGGAGATGG + Intergenic
1101216929 12:102594773-102594795 CCTTAAGTCCTGCAGAGAGAAGG + Intergenic
1101455538 12:104826689-104826711 CTTTAAGTTCTGTAGGGAGAAGG - Intronic
1101466817 12:104958014-104958036 CATCAGGTGCGGGAGGGAGGTGG - Intronic
1102571917 12:113831901-113831923 CCTGCACTGCTGCAGGGAGAAGG + Intronic
1103279909 12:119748689-119748711 CATCACGCTATGCAGGGAGAAGG + Intronic
1104991389 12:132625642-132625664 CACCAGGTCCTGCAGGGTGAAGG + Exonic
1106107924 13:26750422-26750444 CATCAAGGTCTGCAGGTCGAGGG + Intergenic
1107056480 13:36110020-36110042 TCTGAAGTGCAGCAGGGAGAGGG + Intronic
1107720738 13:43245681-43245703 CATCAAAGGCTGCTGGGAAAGGG - Intronic
1109191537 13:59329704-59329726 CCTCAAGTGGTGCAGGGGCAAGG + Intergenic
1112434450 13:99381737-99381759 CATCAGGTTGTGCAGGGAGAGGG - Intronic
1113449820 13:110400374-110400396 CATCAACTCTTTCAGGGAGAAGG - Intronic
1114069612 14:19097062-19097084 CATCACCTGCTGGAGGGAGTGGG + Intergenic
1114602389 14:23967197-23967219 CATCCAGAGCTGCAGGAAGAAGG - Exonic
1114606757 14:24004323-24004345 CATCCAGAGCTGTAGGAAGAAGG - Exonic
1114612058 14:24049271-24049293 CATCCAGAGCTGCAGGAAGAAGG - Intergenic
1118441925 14:65820504-65820526 CATTTAGTGCTGCAGGGCCAGGG - Intergenic
1118856374 14:69626429-69626451 AATCAAGTCCTGCAAGAAGATGG - Intronic
1120409116 14:84129255-84129277 CAGGGAGGGCTGCAGGGAGAAGG + Intergenic
1120745118 14:88145426-88145448 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1121451315 14:94010061-94010083 CTCCAGGTGCTGCTGGGAGAGGG + Intergenic
1123212692 14:106775688-106775710 CTTCCAGTGCTGCAGGGTCAGGG + Intergenic
1125966538 15:43879828-43879850 CCTCGCGTGTTGCAGGGAGAAGG + Intronic
1126574381 15:50182865-50182887 CTTCCAGTGCTGCGGGGCGAAGG + Exonic
1127303383 15:57679525-57679547 TGTCAAATGCTACAGGGAGATGG - Intronic
1127715329 15:61644220-61644242 CATCAAGAGATGGAGGGAGACGG - Intergenic
1129063672 15:72882311-72882333 AAGCAAGTGCTTCAGGCAGAAGG - Intergenic
1129134836 15:73538927-73538949 TATGAAGTGATGCATGGAGAAGG - Intronic
1129458320 15:75687486-75687508 CAGCAGGTCCTGCTGGGAGAAGG + Exonic
1129725461 15:77899379-77899401 CAGCAGGTCCTGCTGGGAGAAGG - Intergenic
1130065215 15:80597213-80597235 CCTAAAGTGCTGCCGGGAGTGGG - Exonic
1130486851 15:84402879-84402901 CAGCAGGTCCTGCTGGGAGAAGG + Intergenic
1130545491 15:84855181-84855203 CAACAAGAGCTGCAGGGTCATGG - Intronic
1130711415 15:86285282-86285304 CATTGAGGGGTGCAGGGAGATGG + Intronic
1132678403 16:1130108-1130130 CATCCAGTGCCGCAGGGAATGGG - Intergenic
1135498187 16:22970776-22970798 CAGCAGCTGCTGCAGGGAGGGGG + Intergenic
1136069101 16:27777596-27777618 CACCAGGAGCTGCAGGGACACGG - Exonic
1137629543 16:49932485-49932507 CAACAAGTTCTGCAGGGGGTCGG + Intergenic
1138407703 16:56811252-56811274 CATCAAGTGTGGCAAGGATATGG - Intronic
1140070967 16:71649330-71649352 CATCCACTGCTGCAGGGGGAGGG - Exonic
1141006863 16:80360519-80360541 CATGAAGGGCTGCTGGGGGAAGG + Intergenic
1141377787 16:83547888-83547910 CATCAGGAGCTGCTGGGGGAGGG + Intronic
1141871250 16:86788294-86788316 TATCAGGGGCTGCAGGGAGAGGG - Intergenic
1142138826 16:88463556-88463578 CTTCAAAGGCTGCCGGGAGAAGG - Intronic
1142713499 17:1736025-1736047 GAACTCGTGCTGCAGGGAGAGGG - Exonic
1142827885 17:2525575-2525597 CCCCAAGCCCTGCAGGGAGAGGG - Intergenic
1143251704 17:5527846-5527868 CATCAAGTGGGCCTGGGAGACGG - Intronic
1144053681 17:11519471-11519493 TACCAAGTGCTGCAGTGAGGAGG + Intronic
1144495687 17:15743355-15743377 CATGAGGTGCTCTAGGGAGAGGG - Exonic
1144638512 17:16925469-16925491 CATGAGGTGCTCTAGGGAGAGGG + Intergenic
1146302121 17:31697537-31697559 CATTTTGTGCTGCTGGGAGATGG - Intergenic
1146943362 17:36858977-36858999 CATGAAGTGGCCCAGGGAGAGGG - Intergenic
1147578736 17:41617038-41617060 CAGGATGTCCTGCAGGGAGATGG + Intergenic
1149088061 17:52743428-52743450 CATCATGTCCTCAAGGGAGAAGG - Intergenic
1149446676 17:56718575-56718597 CATCAGGAACTGGAGGGAGAGGG + Intergenic
1150865763 17:68848204-68848226 AACCAACTGCTGCAGAGAGAGGG + Intergenic
1150915639 17:69433967-69433989 TATGAAGTGCTGCCGAGAGAGGG + Intronic
1152452376 17:80389963-80389985 CATTAAAGCCTGCAGGGAGAAGG - Intronic
1154346817 18:13549443-13549465 CATCAGGTGCTTCTGGGAAAGGG + Intronic
1155089078 18:22488847-22488869 CAGCAAGTGCCTCAGGGATAGGG - Intergenic
1155327583 18:24680721-24680743 CAGCCAATGCTGCAGGGAGCAGG + Intergenic
1155557525 18:27036893-27036915 TATCAGGGGCTGCAGGGAGGAGG + Intronic
1155650510 18:28134972-28134994 CATCATGGGCTGGAGGGAAAGGG + Intronic
1155651103 18:28143088-28143110 CATCATGTGCTGCCCAGAGATGG + Intronic
1157727272 18:49974478-49974500 GATCACCTGCTGCAGGGACATGG + Exonic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1158676212 18:59520880-59520902 CATCCACTGCTGCAGGTAGGAGG - Intronic
1160060298 18:75523912-75523934 CCTCTAGAGCTGCAGGCAGAAGG - Intergenic
1160215014 18:76921094-76921116 CAGCAGGTGCTGCAGGGAAAGGG + Intronic
1160538869 18:79609863-79609885 CCTCATGTGCTCCAGGAAGATGG + Intergenic
1160566018 18:79787187-79787209 CCTCAAATGCAGCGGGGAGACGG + Intergenic
1161133949 19:2608652-2608674 CATCCCCTGCTGCAGAGAGAGGG - Intronic
1163325114 19:16598508-16598530 CAGCAAGTGCTGCTGGGTTAAGG - Intronic
1163414296 19:17176596-17176618 CATCATGCGCTTTAGGGAGATGG + Intronic
925019921 2:560365-560387 CCTCAGGTACTGCAAGGAGAAGG - Intergenic
926141217 2:10369594-10369616 CAGCAAGGGCTCCAGGCAGAGGG + Intronic
929285058 2:40126513-40126535 TATCAAGTGCTGGAGTGAGAAGG + Intronic
929559870 2:42949502-42949524 CATCAAGTGCTGCAGTGGCAGGG + Intergenic
929917129 2:46145308-46145330 CATCTAGTGGTGCTGGGGGAAGG + Intronic
929930989 2:46255328-46255350 CATCGAATGCTGCTGGGAGGTGG - Intergenic
930734164 2:54758201-54758223 TTTCAAGTCCTGAAGGGAGAGGG + Intronic
932335466 2:70928581-70928603 CACCCAGAGCTGCAGGAAGATGG + Intronic
933141102 2:78793735-78793757 CTTTAAGTCCTGTAGGGAGAAGG + Intergenic
935316334 2:101838094-101838116 AATCAAGTTCTGCTGGCAGAAGG - Intronic
935695069 2:105764196-105764218 CAGCAGGTGCTGCAGGGTCAAGG - Intronic
936495455 2:113016641-113016663 CAAAAAGTGCTGTATGGAGAGGG - Intergenic
936662328 2:114556122-114556144 CAAGAAGGGCAGCAGGGAGATGG + Intronic
936809639 2:116382374-116382396 CATAAAGTGATGGAGGGAGAGGG - Intergenic
937463886 2:122112339-122112361 CAGCAAGTGCGGCAGGAAGGAGG - Intergenic
937903782 2:127041811-127041833 CATCGGCTGCTGGAGGGAGAAGG - Intergenic
940409933 2:153349818-153349840 CCTCTAGTGCTGAAGGGAGATGG - Intergenic
941186421 2:162325881-162325903 CGTTAAGTCCTGTAGGGAGACGG + Intronic
942073905 2:172339414-172339436 CACCAAGTGCTGCAGGAGGCAGG + Intergenic
943114019 2:183643894-183643916 CTTCAAGTTCTGCAGGCATAAGG - Intergenic
945042711 2:205755518-205755540 TATCAAGCTCTGTAGGGAGAAGG - Intronic
946157886 2:217818751-217818773 ACTGAAGTGCTGCAGAGAGATGG + Exonic
946223541 2:218249449-218249471 CATCAAGTGCTCTAAGGTGAGGG + Exonic
948980285 2:241491047-241491069 AGCCGAGTGCTGCAGGGAGAAGG - Exonic
1169971820 20:11276892-11276914 CTTCAGGTGCTGCAGGGAGTAGG + Intergenic
1171202722 20:23255033-23255055 CATCAACTCCAGCAGGGAGGGGG - Intergenic
1171408576 20:24930458-24930480 GATCAAGTGCTTGAGGGAGCAGG - Intergenic
1171983466 20:31643319-31643341 CAGCATCTGCTGCAGGGAGGGGG + Intronic
1173201025 20:40955249-40955271 CACCAAGGCCTGCAGGGACAAGG + Intergenic
1173534690 20:43800510-43800532 CACCACATGCTGCGGGGAGATGG - Intergenic
1174410727 20:50333315-50333337 CATGAAGTCCTACGGGGAGAGGG + Intergenic
1175959613 20:62628847-62628869 CATCAAGCCCTGCAGGGGGCTGG - Intergenic
1175985878 20:62763967-62763989 CTCTAAGTGCTGCAGGGAGGTGG - Intergenic
1178416148 21:32406709-32406731 CAGCAAATGCTACAGGGAGCCGG - Intergenic
1178428811 21:32501211-32501233 CATCAAATGCTCCAGAGAGGTGG - Intronic
1179098479 21:38336264-38336286 CATCTAGAGCTCTAGGGAGAGGG - Intergenic
1182077770 22:27506536-27506558 GATCAGGTGCTTCAGGGGGAGGG + Intergenic
1183967287 22:41449540-41449562 AAGCAAGTGAGGCAGGGAGAAGG + Intergenic
1183978938 22:41528465-41528487 CTTCAGGGGCTGCAAGGAGAAGG - Exonic
1184555479 22:45230415-45230437 CATGACCTGCTTCAGGGAGAAGG - Intronic
1184648545 22:45909062-45909084 CCGCATGTGCTGGAGGGAGAGGG - Intergenic
949946441 3:9193541-9193563 CACCAAGTGCTGGCGGGAGATGG + Intronic
950883052 3:16338509-16338531 CATTGAGTGCTTCAGGGTGAGGG + Intronic
951435696 3:22661103-22661125 CATCAAGTCATGAAAGGAGATGG + Intergenic
951759925 3:26136201-26136223 AAGCAAGTGCTTCAGGTAGAGGG + Intergenic
952003210 3:28810127-28810149 CTTTAAGTTCTGCAGAGAGAAGG + Intergenic
952886948 3:38017891-38017913 CACCAGGGGCTGCAGGCAGAGGG - Intronic
954716771 3:52530871-52530893 AAGCAGGGGCTGCAGGGAGAAGG + Intronic
955184828 3:56704892-56704914 TAGCAAGTACTGCGGGGAGAGGG - Intergenic
956956452 3:74346817-74346839 CATGAAGGGCTTCAGGGAGGGGG + Intronic
958705820 3:97653968-97653990 TACCAAGAGCTGCAGGGAGAGGG + Intronic
961689961 3:128662270-128662292 GACTAAGAGCTGCAGGGAGAGGG - Intronic
962515087 3:136142667-136142689 CTTCAAGTGCTGTGAGGAGAGGG + Intronic
962663621 3:137631170-137631192 CATCAAGTTTTACAGGGTGAAGG + Intergenic
963235804 3:142954438-142954460 CATAAAATGCAGCAGGCAGAAGG - Intronic
965160150 3:165122721-165122743 TTTCAAGTGCTGTAGTGAGAAGG + Intergenic
966929536 3:184666918-184666940 CATTAAGTGCTACAGGGATCAGG + Intronic
968991738 4:3918080-3918102 CATCAAATGCTCCAGAGAGGTGG + Intergenic
969527999 4:7713829-7713851 CAGCAGCTGTTGCAGGGAGATGG + Intronic
969823607 4:9739408-9739430 CATCAAGTGCTCCAGAGAGGTGG - Intergenic
970733591 4:19138689-19138711 TACCAAGGGCTGAAGGGAGAGGG - Intergenic
972156917 4:36174729-36174751 CATCATGTGAAGAAGGGAGATGG - Intronic
972390413 4:38607961-38607983 CATGAAGTCATCCAGGGAGATGG + Intergenic
972399391 4:38686602-38686624 TAACGAGTGCTCCAGGGAGATGG + Intronic
973809366 4:54554828-54554850 CAGCAGGTGCTCCAGGGAGCTGG + Intergenic
973852553 4:54975508-54975530 AGCCAAGTGTTGCAGGGAGATGG - Intergenic
974240291 4:59237918-59237940 CATCAAGTGGAGCAGGGTGTTGG + Intergenic
976160599 4:82194511-82194533 CAACACGTGATGCAGGGATAGGG - Intergenic
977151668 4:93520481-93520503 CAGGAAGTGCTCCAGGCAGAGGG + Intronic
977362213 4:96020481-96020503 CATGAAGTCCTCCAAGGAGAAGG + Intergenic
978039735 4:104045109-104045131 CACCAAGTGATGCAGGCAGCTGG - Intergenic
980175905 4:129344149-129344171 CATCGAGTACTGCCAGGAGATGG + Intergenic
982459285 4:155648479-155648501 CATCAATTGCTTCTGGGGGAAGG + Intergenic
984439386 4:179747127-179747149 CAACAAGTGGTGTAGGGAAACGG + Intergenic
985510954 5:313625-313647 CATCAAGACCTGCAGGAACATGG - Intronic
985747875 5:1657390-1657412 CGTGAAGAGATGCAGGGAGAAGG - Intergenic
990242098 5:53826098-53826120 TGTCAGGGGCTGCAGGGAGAGGG + Intergenic
991490282 5:67176187-67176209 CATTAAGCGCTGCCAGGAGATGG + Intergenic
991598264 5:68326618-68326640 CATCAACTTCTGCAGGCAGTCGG + Intergenic
992355937 5:75983385-75983407 CATCAAAAGCTGCAGAAAGAAGG + Intergenic
1002963936 6:1943490-1943512 CAACATTTTCTGCAGGGAGAGGG + Intronic
1003524812 6:6888837-6888859 CATCAGGGGCTGGAAGGAGAAGG + Intergenic
1003623454 6:7722965-7722987 CATTAAGTGGGGCAGGGAGATGG + Intergenic
1003807355 6:9740330-9740352 CATTAAGTGAGGCAGGGAGAAGG - Intronic
1004406604 6:15338819-15338841 CTTTAAGTCCTGTAGGGAGAAGG - Intronic
1004979757 6:21010476-21010498 CATCACTTGCTGCAGGCACAAGG + Intronic
1005886257 6:30100277-30100299 CGGTAAGTGCTGCAGGGAGATGG + Intergenic
1006092005 6:31633694-31633716 GGTCAAGTGCTGGAGGGAGCGGG + Intronic
1006236001 6:32633091-32633113 CCTGGAGTGCTACAGGGAGAAGG + Intronic
1006389929 6:33752257-33752279 CATCAAGGACTGCAGGAGGAAGG + Intergenic
1006443854 6:34068137-34068159 CATGACGTGCTGGAGGGAGACGG + Intronic
1008047572 6:46866976-46866998 CATCAAGTGCTGCATAGAGGAGG - Exonic
1008328379 6:50215119-50215141 GAGCAAGTGCTGCAGGGAGAAGG + Intergenic
1008736783 6:54554467-54554489 CATTAAGTTTTGAAGGGAGAAGG - Intergenic
1011090610 6:83594389-83594411 CATCAAGTGCTGCTGCTACAGGG + Exonic
1013287007 6:108690505-108690527 CATGAAGTGGACCAGGGAGAGGG - Intergenic
1013605725 6:111745688-111745710 CAGCATGTTCTGGAGGGAGAAGG + Intronic
1014535283 6:122606885-122606907 GACCAAGAGATGCAGGGAGAAGG - Intronic
1015803253 6:137081964-137081986 TATCATATGCTGCAGTGAGATGG + Intergenic
1015924202 6:138293140-138293162 CATGAGCTGCTTCAGGGAGAGGG - Intronic
1018560874 6:165099755-165099777 TATCAAGTGCTGCTAGTAGAGGG + Intergenic
1019035178 6:169048682-169048704 GATCAAGTCGTGCAGTGAGATGG - Intergenic
1019175665 6:170158168-170158190 CATCAAGAGATGGTGGGAGAGGG + Intergenic
1019382218 7:729711-729733 CTTCCAGTGCTGGTGGGAGATGG - Exonic
1019591623 7:1838600-1838622 CCTGCAGTGTTGCAGGGAGATGG - Exonic
1020314544 7:6895864-6895886 CATCAAATGCTCCAGAGAGGTGG + Intergenic
1021805319 7:24349316-24349338 TATGATGTGCTACAGGGAGAGGG + Intergenic
1025093587 7:56081669-56081691 CACCAAGTACTGCTGGAAGAAGG + Exonic
1025216603 7:57061215-57061237 CACCACGTACTGCAGGAAGAAGG + Intergenic
1025654776 7:63509515-63509537 CACCACGTACTGCAGGAAGAAGG - Intergenic
1026368467 7:69673799-69673821 CACCATGTGCTCCAGGGAAAAGG + Intronic
1026415779 7:70179105-70179127 CATAAAATGCCACAGGGAGATGG - Intronic
1030083006 7:105793519-105793541 CATGAAGTTCTGCAGTCAGAGGG - Intronic
1031495498 7:122442408-122442430 GATCAAGTGCTACAGGCAGCTGG + Intronic
1032122196 7:129164931-129164953 AGTCAAGTGCAGCAGTGAGAAGG - Intronic
1035491245 7:159280664-159280686 CACCAAATGCTGCAGAGACATGG - Intergenic
1036568665 8:9960362-9960384 CCTCAAGTGCTGGATGGGGAAGG + Intergenic
1036927064 8:12917277-12917299 CATCAAGTACTTAATGGAGAGGG - Intergenic
1037710224 8:21349481-21349503 CAGCTTGTTCTGCAGGGAGATGG - Intergenic
1037753940 8:21699586-21699608 CAGTGAGGGCTGCAGGGAGACGG - Intronic
1040073434 8:43206459-43206481 CATCACCTGCTGGAGGGAGCCGG + Intergenic
1040275738 8:46012785-46012807 CATGAAGGGCTCCAGGGAAAGGG - Intergenic
1040678831 8:49785006-49785028 CATCCAGAGCTTTAGGGAGATGG + Intergenic
1042657673 8:71117985-71118007 CATCAAATGCTGCAAGGATGTGG - Intergenic
1042874100 8:73424954-73424976 CCTGGAGTGCTGCAGGGAGAAGG + Intronic
1044469309 8:92547712-92547734 CATCAATAACTGCAGGGAGTGGG - Intergenic
1045217078 8:100158945-100158967 AATCAAGTGCAGTAGTGAGAAGG - Intronic
1046138711 8:110062513-110062535 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1048623262 8:136158185-136158207 ATCCAAGTGCTGCAGGCAGAGGG - Intergenic
1048791654 8:138109745-138109767 CTTCAAGTGCTGGAGTGTGAAGG - Intergenic
1048819188 8:138364137-138364159 CAGCAAGTGTTCCATGGAGAGGG - Intronic
1048994627 8:139786406-139786428 CATCAAGTGCGGTGGGGAGGCGG + Intronic
1049432240 8:142570566-142570588 CATCAAGTGTTGCATGTGGAAGG + Intergenic
1054728429 9:68676317-68676339 CATCAAAAGAAGCAGGGAGAAGG - Intergenic
1055139163 9:72856024-72856046 AATCAACTGCTGCAGTCAGATGG - Intergenic
1056495066 9:87148286-87148308 CTTCCAGTGCTGCCAGGAGAGGG + Intergenic
1057006477 9:91565348-91565370 CATCAAATCCTGCAGGCTGAGGG + Intronic
1057293472 9:93821589-93821611 CATCCAGTGCTGCAGAGGAAGGG - Intergenic
1057309590 9:93933690-93933712 CAGCAAATGCTGCCGGGGGAAGG + Intergenic
1057438318 9:95062820-95062842 CATCACGTGATGCAGGCACATGG - Intronic
1057686455 9:97238744-97238766 AATCAGGTGCTGCTGGGAGGAGG - Intergenic
1058886422 9:109324766-109324788 ACTCAAGTGCAGCAGTGAGACGG - Intergenic
1058963075 9:110009802-110009824 CATGAGGATCTGCAGGGAGAGGG - Intronic
1060495542 9:124115771-124115793 TATCAGGGGCTGGAGGGAGAGGG + Intergenic
1060925333 9:127451768-127451790 CAACAAGTGCTCGAGGGAGCAGG - Exonic
1061512375 9:131069034-131069056 CATCAAGGGCTGCCGGGGTAAGG + Exonic
1061588696 9:131584404-131584426 CCGCAAGTGCTGCCGAGAGAGGG + Exonic
1062342948 9:136101880-136101902 CACCTGCTGCTGCAGGGAGATGG - Intergenic
1186241393 X:7570823-7570845 CATCAGGTGCTTCAGGCAGATGG + Intergenic
1189888108 X:45570326-45570348 CATCAAGTGCTGGGGATAGAGGG + Intergenic
1193454954 X:81720158-81720180 CAACAACTGATGCAGTGAGAAGG + Intergenic
1196505447 X:116436261-116436283 GTACAAGTGCTGGAGGGAGAAGG - Intergenic
1199248286 X:145631626-145631648 CATCATGCGCTGCTGGAAGAAGG + Intergenic
1200120309 X:153787110-153787132 CCTCCAGTGCTGCAGGGAGGTGG - Exonic
1201921056 Y:19233481-19233503 CTTCAAGTACTATAGGGAGAAGG - Intergenic