ID: 912449563

View in Genome Browser
Species Human (GRCh38)
Location 1:109760761-109760783
Sequence GGCTCCAATGGAGAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912449563_912449567 -3 Left 912449563 1:109760761-109760783 CCTGCTTGTTCTCCATTGGAGCC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 912449567 1:109760781-109760803 GCCACTAACAAGTGGTGGCCAGG No data
912449563_912449566 -8 Left 912449563 1:109760761-109760783 CCTGCTTGTTCTCCATTGGAGCC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 912449566 1:109760776-109760798 TTGGAGCCACTAACAAGTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 69
912449563_912449569 2 Left 912449563 1:109760761-109760783 CCTGCTTGTTCTCCATTGGAGCC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 912449569 1:109760786-109760808 TAACAAGTGGTGGCCAGGACAGG 0: 1
1: 0
2: 2
3: 35
4: 237
912449563_912449570 6 Left 912449563 1:109760761-109760783 CCTGCTTGTTCTCCATTGGAGCC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 912449570 1:109760790-109760812 AAGTGGTGGCCAGGACAGGATGG 0: 1
1: 0
2: 2
3: 40
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912449563 Original CRISPR GGCTCCAATGGAGAACAAGC AGG (reversed) Intronic
900875730 1:5341287-5341309 GGCTATAGTGGTGAACAAGCCGG - Intergenic
904711494 1:32433587-32433609 GGCTCTAAGGGAGAAGAAGGAGG - Intergenic
906274836 1:44507887-44507909 GGCTCAAAGGGAGAAAAAGAAGG - Intronic
907554426 1:55332403-55332425 GGCTCCAAAGGAGAAGGAGTGGG - Intergenic
909490998 1:76226335-76226357 GGCTCCCTTGGAGAGCAAACAGG - Intronic
910610271 1:89133901-89133923 GGCTGCAGTGGAGCACAACCAGG + Intronic
910614863 1:89186392-89186414 GGCCCAAATGGAGAAGAAGTTGG - Exonic
910872016 1:91842609-91842631 GCTCCCAATGGAGAAAAAGCAGG - Intronic
912449563 1:109760761-109760783 GGCTCCAATGGAGAACAAGCAGG - Intronic
913445212 1:118943813-118943835 GGCTCCCAGGGAGCACGAGCAGG + Intronic
917965475 1:180176005-180176027 GGCTCCAGTGGGGGACAGGCTGG - Exonic
919961123 1:202470029-202470051 GCCTCCAATGGGGAAAAAGGGGG - Intronic
922949858 1:229549608-229549630 GGTTCCAGGTGAGAACAAGCAGG + Intronic
923728269 1:236526042-236526064 GACTCCAATCGACAAGAAGCTGG + Exonic
1062997545 10:1881239-1881261 GGATCCCATGGAGGAGAAGCAGG - Intergenic
1064923450 10:20543563-20543585 GGCCCCAATGAAGAACCTGCAGG + Intergenic
1066005709 10:31144448-31144470 AGCTCTCATGGAGAGCAAGCTGG - Intergenic
1075370003 10:121927831-121927853 CGCTCCAATGGTGAGCGAGCCGG - Exonic
1075468723 10:122672099-122672121 GGCTTCTGTGGAGAACAGGCTGG - Intergenic
1077092835 11:787493-787515 GGCTCCCCTGGAGCACAAGCTGG + Exonic
1077648335 11:3946537-3946559 GAATCCAACGAAGAACAAGCAGG - Intronic
1080341932 11:31274552-31274574 GGCTCCATGGCAGAGCAAGCAGG + Intronic
1083967382 11:66051107-66051129 GCCCCCAGTGGAGAAGAAGCTGG - Intronic
1092540694 12:9418355-9418377 GCCTCCTGTGGAGACCAAGCGGG + Intergenic
1093937874 12:25020385-25020407 GGCTACAATGGTGAACAAAAGGG - Intergenic
1104331881 12:127854713-127854735 GGCTCCAGTGCAGAAGAAGAGGG + Intergenic
1110361816 13:74634420-74634442 CACTCCAATGGAGCACAAGGTGG + Intergenic
1112468750 13:99668908-99668930 GGCTCCAGGGCAGGACAAGCTGG + Intronic
1114976200 14:28103175-28103197 GGTTCCAGTGGAGAAAAACCTGG - Intergenic
1116725997 14:48562136-48562158 GTCTCCAGTGGAGTGCAAGCAGG - Intergenic
1118381084 14:65217859-65217881 GTCACCATTGGAGAACCAGCAGG + Intergenic
1119818776 14:77595544-77595566 GGCTCGGATGGAGTACAAGATGG + Intronic
1124706453 15:31970431-31970453 GGGGCCAATGGAGCCCAAGCGGG + Intergenic
1126750736 15:51874506-51874528 TTCTCCAAACGAGAACAAGCTGG - Intronic
1129362809 15:75034803-75034825 GCCTCCACTGGAGACCAAGGAGG - Intronic
1131408455 15:92185834-92185856 GGCTCCAATTGAGAAGACACAGG + Intergenic
1133906437 16:10026920-10026942 GGGTCCACTTGAGAACAGGCAGG - Intronic
1135949667 16:26902276-26902298 GGCTGCTAGGGAGAACAAACAGG + Intergenic
1137692718 16:50440778-50440800 GGTTCCTGTGGAGAACCAGCAGG + Intergenic
1140786870 16:78350870-78350892 GGCTGCTGTGGAGAACAATCTGG - Intronic
1141288550 16:82695474-82695496 GGCTCCAATGGTGAGCAGGAAGG + Intronic
1141714567 16:85719347-85719369 GGGTCAACTGGAGAAAAAGCAGG + Intronic
1147182081 17:38692821-38692843 GGGTGGAATGGAGAAGAAGCTGG + Intergenic
1151644868 17:75423559-75423581 GCCTCCAACGGAGATCAAGGTGG - Intergenic
1153080466 18:1217876-1217898 GGCTACACTGGGGAACAACCAGG - Intergenic
1154147849 18:11880863-11880885 TGCTCCCATGCAAAACAAGCAGG + Intronic
1154315116 18:13298140-13298162 GGGTGCAATGGTGCACAAGCTGG + Intronic
1156528196 18:37788450-37788472 GACTGGAATGGAGAACAAGAGGG + Intergenic
1157447747 18:47758003-47758025 GGCCCCATTGGAGAACAAGATGG - Intergenic
1157487605 18:48099709-48099731 GGGGCCAATTGAGAACCAGCTGG - Intronic
1160140519 18:76317752-76317774 GGCTGCTAGAGAGAACAAGCTGG - Intergenic
1162519716 19:11172696-11172718 GACTGAAATGGCGAACAAGCAGG - Intronic
1163385118 19:16995190-16995212 GGTTCCAAAGCAGAACAAGAGGG + Intronic
1165105516 19:33467585-33467607 GGCTCAAATGTAGGACAAGAAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167259789 19:48451887-48451909 AGTTCCAATGGTCAACAAGCTGG - Intronic
930299466 2:49596452-49596474 GGCTGCCATGGAGAGCAAGAGGG - Intergenic
932760874 2:74438471-74438493 GGCTGCTATGGAGAATAGGCTGG - Intronic
934220396 2:90076899-90076921 GGCACCAAAGGAGAAGAAGATGG - Intergenic
936740016 2:115493837-115493859 GGCTGTTATGGAGAACAAGGTGG + Intronic
937008014 2:118535739-118535761 GGCGCCCATGGAGCACAAACAGG - Intergenic
942333607 2:174855569-174855591 GGCTCTAATGGAGAAAAAATAGG - Intronic
947346171 2:229191252-229191274 GCCACCGATGGAGAACAAGTGGG + Intronic
948068148 2:235097478-235097500 GGCACCTAGGGAGAACATGCTGG + Intergenic
1170219685 20:13929143-13929165 GGCTCTCAGGGAGAACAGGCTGG - Intronic
1171048734 20:21836055-21836077 GGCCCCACTGGAGTACAAGGAGG + Intergenic
1172597178 20:36157532-36157554 GGCTCCACTGGACACCAACCTGG - Intronic
1173559566 20:43993269-43993291 GGCTGCTATGGAGAACAATTTGG + Intronic
1175884009 20:62278089-62278111 GGCTCAGGTGGAGAGCAAGCGGG + Intronic
1178260014 21:31090107-31090129 GGCTGCCATGGAGAACAATATGG - Intergenic
1179178684 21:39027088-39027110 GGCTCCAAAGGTGGACATGCTGG - Intergenic
1180834447 22:18922834-18922856 GGCTGCCATGGACACCAAGCTGG - Exonic
1180946073 22:19694282-19694304 GGATCCAATGCAGGACAAGTAGG + Intergenic
1181293817 22:21818973-21818995 GGCTCCAATGGCTAACCAGGGGG + Intronic
1181972097 22:26698657-26698679 GGCTACAATGGAGGACAAACAGG - Intergenic
1182134025 22:27883835-27883857 GTCTCCAAAGGAGACCAAACTGG + Intronic
1203284536 22_KI270734v1_random:148133-148155 GGCTGCCATGGACACCAAGCTGG - Intergenic
950923857 3:16720950-16720972 GGGTCCAATGGAGGCCCAGCAGG - Intergenic
952336421 3:32407086-32407108 GGCTCCTATGGAATACCAGCAGG - Intronic
962753232 3:138449992-138450014 TGCTGCAATGGAGAACCAGCAGG + Intronic
963008422 3:140748124-140748146 GGCCCCCAAGGAGGACAAGCTGG - Intergenic
965619435 3:170627747-170627769 CACTCACATGGAGAACAAGCAGG + Intronic
966391769 3:179460126-179460148 GGCCACAATGCAGAAAAAGCAGG - Intergenic
966681341 3:182644826-182644848 GAATACAATGGTGAACAAGCCGG - Intergenic
967752992 3:193135895-193135917 GGCTTCAATGTAGAAAAACCAGG - Intergenic
969145820 4:5123320-5123342 GGCTCCAAGGAAGATGAAGCCGG - Intronic
969868923 4:10092937-10092959 GGCTGCAAGGGAGGACAGGCAGG - Intronic
971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG + Intronic
983098959 4:163600749-163600771 GGGTCCAAATAAGAACAAGCTGG + Intronic
983728979 4:170970422-170970444 AGCTCCAATGTAGAGCATGCAGG - Intergenic
990134711 5:52631333-52631355 GGCTGCAAAGGAGCACAAGCAGG - Intergenic
990324289 5:54659786-54659808 GGCACCAATGGAGCTGAAGCAGG + Intergenic
994685206 5:102942258-102942280 GGCTCCCAAGGTGATCAAGCAGG - Intronic
997951172 5:138243720-138243742 GACTCAAATGCAGATCAAGCTGG + Intergenic
1001598615 5:172914634-172914656 GGCTCCCAGAGAGAACAGGCTGG + Intronic
1004011158 6:11689036-11689058 GTCTCCAAAAGAGACCAAGCAGG - Intergenic
1005271846 6:24174046-24174068 GGCTCCAATGGCGCACACTCAGG - Exonic
1005693843 6:28333370-28333392 GGCTACAATGGTGAAAAAGACGG + Intronic
1006003639 6:30986279-30986301 GGCTCCACTGGAGATCACACTGG - Exonic
1010890229 6:81298868-81298890 TTCTCCAGTTGAGAACAAGCAGG + Intergenic
1012253717 6:97008495-97008517 GGCTGCAATGGAGCACAGCCAGG - Intronic
1017504024 6:155051105-155051127 GGTTCTGATTGAGAACAAGCTGG + Intronic
1031983111 7:128142442-128142464 GGGGCCAATAAAGAACAAGCTGG + Intergenic
1033477563 7:141705402-141705424 CGCTCCAAGGAAGAACATGCTGG - Intergenic
1039898128 8:41730775-41730797 GGCTCCCATGGAAAAGAAGGAGG + Intronic
1041753728 8:61289710-61289732 GCCTCTAATGGTGAGCAAGCTGG - Intronic
1043353088 8:79384525-79384547 GGCTCCAGTGGAGAGGAAGGGGG + Intergenic
1043438713 8:80258330-80258352 GGCTCCGATGTTGAACAAGATGG + Intergenic
1043784529 8:84381199-84381221 GACTTCTGTGGAGAACAAGCAGG - Intronic
1047403195 8:124562988-124563010 GGCTGCTGTGGAGGACAAGCAGG + Exonic
1047459225 8:125046284-125046306 GGCTCAAATGAAGAAAAAGGAGG + Intronic
1049926878 9:418097-418119 GGCTCGGATGAAGAACAAGAAGG + Exonic
1049991521 9:996138-996160 GGCTGCAATGGACAGCCAGCAGG - Intergenic
1050641879 9:7677119-7677141 GGCTGCAATGGGAAAGAAGCTGG + Intergenic
1053379904 9:37640191-37640213 GGCTCCAAAGGACATCAAGGTGG + Intronic
1057023067 9:91715593-91715615 GGGTTCAGTGGTGAACAAGCTGG - Intronic
1057692127 9:97294743-97294765 GGCACCATTGGAGAGCAAACTGG + Intergenic
1058334998 9:103815850-103815872 GACTCTATTGGAGAACAACCAGG - Intergenic
1059209707 9:112501508-112501530 GGCTGCAATGGAGAATAACAAGG + Intronic
1061014221 9:127972661-127972683 GGCAACAAGGCAGAACAAGCAGG + Intronic
1061947229 9:133915096-133915118 GACACTAATGGAGAACAGGCCGG - Intronic
1189891852 X:45610884-45610906 GTCTGCAGTGGAGAACAACCAGG - Intergenic
1193028245 X:76869236-76869258 GGCTCCAATAGAGTAATAGCTGG + Intergenic
1199381703 X:147179852-147179874 AGCACAAATGGAGAACAAGTGGG + Intergenic