ID: 912450300

View in Genome Browser
Species Human (GRCh38)
Location 1:109764131-109764153
Sequence CCTAAAAGGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 544}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912450300_912450314 15 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450314 1:109764169-109764191 ACAGGTCAGCATCAGGCACGGGG 0: 1
1: 0
2: 0
3: 14
4: 145
912450300_912450312 13 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450312 1:109764167-109764189 GAACAGGTCAGCATCAGGCACGG 0: 1
1: 0
2: 1
3: 12
4: 199
912450300_912450309 -3 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450300_912450315 19 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450315 1:109764173-109764195 GTCAGCATCAGGCACGGGGCTGG 0: 1
1: 1
2: 1
3: 17
4: 190
912450300_912450311 8 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450311 1:109764162-109764184 CTGGGGAACAGGTCAGCATCAGG 0: 1
1: 0
2: 0
3: 25
4: 191
912450300_912450308 -9 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450308 1:109764145-109764167 CCTTTTAGGTGCCTACTCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 126
912450300_912450313 14 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450313 1:109764168-109764190 AACAGGTCAGCATCAGGCACGGG 0: 1
1: 0
2: 0
3: 17
4: 174
912450300_912450306 -10 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450306 1:109764144-109764166 GCCTTTTAGGTGCCTACTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 107
912450300_912450316 20 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450316 1:109764174-109764196 TCAGCATCAGGCACGGGGCTGGG 0: 1
1: 0
2: 2
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912450300 Original CRISPR CCTAAAAGGCAGAGGGAAGA GGG (reversed) Intronic
900779946 1:4611572-4611594 CCCTAAAGGAGGAGGGAAGATGG + Intergenic
901495315 1:9617860-9617882 CTACAAAGGCAGAGGGAAGTGGG + Intergenic
901651424 1:10745305-10745327 CCTATAAGACAGAGGTCAGATGG + Intronic
902178576 1:14670149-14670171 CCTAAAAGCAGGATGGAAGAAGG - Intronic
902614804 1:17618077-17618099 CCCAAAATGCAGAGGGAACATGG - Intronic
902645968 1:17798135-17798157 CCTAGAAGGCAGAGGTCATATGG + Intronic
903221291 1:21870964-21870986 CCCAGAAGGGAGAGGGGAGAAGG + Intronic
903770221 1:25759129-25759151 CTAAACAGGCACAGGGAAGAAGG - Intronic
903832388 1:26182987-26183009 GCTAAGAGCCAGAGGGAAGCTGG - Intronic
903912923 1:26741485-26741507 TGTATAAGGCAGATGGAAGAGGG + Intronic
904374945 1:30074790-30074812 CTTAAAAGTTAGAGGCAAGATGG - Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904512116 1:31020059-31020081 CCAAAAAGGGAAAGGGAAGGAGG - Intronic
905272247 1:36794741-36794763 CCCAAAAGGGAGTGGGAAGGTGG - Intergenic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905715422 1:40145432-40145454 CCCAAAGGGCAGAGGAAAGAAGG + Intergenic
906395296 1:45458259-45458281 ACTAAAAGGCAGAGATAAAATGG + Intronic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907958031 1:59250168-59250190 ACTAAAATGCAGTGGGAAGAAGG + Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909431659 1:75594749-75594771 AGAAAAAGGCAGAGGGAAGATGG + Intronic
910482317 1:87672406-87672428 CCTACAGGGTAGAGAGAAGAGGG + Intergenic
910980673 1:92957657-92957679 AGCAAAAGGCAGAGAGAAGAAGG + Intronic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
911279382 1:95903717-95903739 CCCACAAGCCAGAGGAAAGATGG - Intergenic
911908169 1:103595544-103595566 ACTAAAATGGAGAGGGATGAGGG + Intergenic
911914749 1:103683922-103683944 ACTAAAATGGAGAGGGATGAGGG - Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912520169 1:110239807-110239829 TCTAAAAGGAAGAGAGAGGAAGG - Intronic
912786187 1:112606028-112606050 ACTAAAAGGGACAGGGAAGGTGG - Intronic
913084438 1:115423760-115423782 CCTAAAAGGGTGAGAGAAAAGGG - Intergenic
914465041 1:147920048-147920070 CCCAAAAGGGAAAGGGAAGCTGG + Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915845089 1:159254460-159254482 CTTAAAAGGCAGAGTGAGGCTGG + Intergenic
916843660 1:168626399-168626421 CCTAAATGGCACTGGGGAGACGG - Intergenic
917598165 1:176550780-176550802 CTCAAAACGCACAGGGAAGAGGG + Intronic
918404692 1:184200206-184200228 CCTAAAAAGAAGAGGGAGTAGGG - Intergenic
918975401 1:191477935-191477957 CATAAAAGGGAGAGAGAAAAAGG - Intergenic
919119036 1:193315855-193315877 CGTTAAAGGGAGAGGGAAGGAGG - Intergenic
919258215 1:195154214-195154236 ACTAAAAGAAAGAGGGAAGGAGG - Intergenic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920940245 1:210475284-210475306 CATTAAAGGTAGAGGGATGAAGG - Intronic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
921427487 1:215021481-215021503 ACAAAAAGACAGAGGAAAGATGG + Intronic
921485264 1:215708066-215708088 CCCAGAAGACAGTGGGAAGAAGG + Intronic
922174111 1:223181690-223181712 TCTGAAAGGCAGAGAGAAGGAGG + Intergenic
922639239 1:227210387-227210409 CCCAAAAGGTAGAGAGAATAAGG - Intronic
922737652 1:227996910-227996932 TCAAGAAGGCAGAGGAAAGATGG + Intergenic
923881960 1:238113296-238113318 TTTAAAATGCAGAGGAAAGATGG + Intergenic
924815511 1:247438252-247438274 CCTAAAAATAAGAGCGAAGAAGG - Intronic
1062949042 10:1482807-1482829 CCTAGAACACAGATGGAAGAAGG - Intronic
1063097313 10:2919741-2919763 CCTAAGGGGCAGAGAGCAGAGGG - Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063608220 10:7541507-7541529 CCGAAAAGACAGGGGGAAGGGGG - Intergenic
1064227846 10:13503323-13503345 GCTGAAAGGAAGAGGGCAGAAGG + Intronic
1065468772 10:26054668-26054690 CTTATAAGACAGAGGCAAGAAGG + Intronic
1065741105 10:28797886-28797908 AAAAAAAGGCAGAGGGGAGAGGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066276799 10:33876809-33876831 TCTAAAGGCCCGAGGGAAGATGG - Intergenic
1067511052 10:46895433-46895455 TCTAAAAGGCAAGGGGAAGGTGG + Intergenic
1067651201 10:48156429-48156451 TCTAAAAGGCAAGGGGAAGGTGG - Intergenic
1067911937 10:50355281-50355303 GCAAAGAGGGAGAGGGAAGAGGG - Intronic
1068468523 10:57427939-57427961 TAAAAAAGGCAGAGGTAAGAAGG - Intergenic
1068714507 10:60173666-60173688 ACTAAAAGGAAGAGGGAGGCTGG + Intronic
1068875385 10:61990433-61990455 CCTAAAAGGCTGAAGGAATCTGG - Intronic
1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG + Intronic
1071276830 10:84063329-84063351 AATAAGAGGCAGAGGCAAGATGG - Intergenic
1071381268 10:85062707-85062729 CCTAAAAAGAAGAAGAAAGACGG - Intergenic
1072262688 10:93696140-93696162 TCTAAAAGGTGGAAGGAAGAAGG + Intronic
1072312563 10:94170774-94170796 CTTAAATGGAAGAGGAAAGAAGG - Intronic
1072566977 10:96624910-96624932 CCTAAATAGCAGAGGGAGTAGGG - Intronic
1072574384 10:96686943-96686965 TCTAAAACACAGAGGGAAAAAGG - Intronic
1072607714 10:96998480-96998502 CCTAAAATGCAGAGCGAACTAGG + Exonic
1073213941 10:101826376-101826398 CTTAGAAGGGAGAGGGAAGGAGG - Intronic
1073615753 10:104993053-104993075 CCTAGAAGTCACAGGGGAGAGGG + Intronic
1074044223 10:109821741-109821763 CCTTAGAGGAACAGGGAAGAGGG + Intergenic
1074969166 10:118521445-118521467 CTCAAAAGGCATAGGGAAGCAGG + Intergenic
1075428437 10:122361035-122361057 CCTGACAGGCACTGGGAAGAGGG + Intergenic
1076234550 10:128853455-128853477 CCTGAAAGGCAGGGGAAAGTTGG - Intergenic
1076276645 10:129205030-129205052 CTTAAAAGGCAAAGTAAAGAGGG + Intergenic
1076369785 10:129945033-129945055 TGTAAAAGGAAAAGGGAAGATGG + Intronic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079755094 11:24248761-24248783 CCAAGAAGGCAGTGGGATGAGGG + Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1082171069 11:49006369-49006391 GGTAAAAGGCAGAGGGTATAGGG - Intergenic
1082828242 11:57597170-57597192 CCTACAGGGCACAGGGGAGATGG + Intergenic
1083633595 11:64108500-64108522 CAAATAAGACAGAGGGAAGAGGG - Intronic
1083758480 11:64803433-64803455 GCCAGAAGACAGAGGGAAGAGGG + Intergenic
1084723927 11:70928170-70928192 CCTGAAACCCAGAGGGAAAAGGG + Intronic
1084810668 11:71609102-71609124 CCTAAGAGCCAGGGGGGAGAGGG + Intergenic
1084946829 11:72642889-72642911 CCTAGGAGGCAGGGGGAAGTCGG + Intronic
1084961987 11:72721612-72721634 CCTAGAAAGCCCAGGGAAGAGGG + Intronic
1085219789 11:74864340-74864362 GCAAAAAGGCAGAGAGAAGATGG + Intronic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1085741410 11:79080910-79080932 ACTAGGAAGCAGAGGGAAGAGGG + Intronic
1088072905 11:105811955-105811977 CCTAAAAAGCATGGGGGAGAGGG - Intronic
1088096998 11:106113055-106113077 CAGAAAAGGCAGAGGGTAAATGG - Intergenic
1088780640 11:113131028-113131050 CCTAAAAGTCACAGGACAGACGG + Intronic
1090859427 11:130639908-130639930 ACCAAAAGGCAGAGGAAAGGAGG - Intergenic
1091714113 12:2764807-2764829 GCTAAAGAGCAGAAGGAAGAAGG + Intergenic
1092310799 12:7349946-7349968 CAATAAAGGCAAAGGGAAGAGGG - Intronic
1092548022 12:9468466-9468488 GCTAAAGGGCAGAAGGAAAAAGG + Intergenic
1093134172 12:15430257-15430279 TCTAAAAGGCAGGCAGAAGAAGG + Intronic
1094504979 12:31053982-31054004 GCTAAAGGGCAGAAGGAAAAAGG - Intergenic
1095359140 12:41314579-41314601 TCCAAAAGGAAGAAGGAAGAGGG + Intronic
1095380871 12:41590129-41590151 CCTAACATGCACTGGGAAGATGG - Intergenic
1095508873 12:42927792-42927814 CCGAAAAGGCAAGGGGAATAGGG + Intergenic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1096812581 12:54181051-54181073 CCAACAATGAAGAGGGAAGAGGG + Intronic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1097623861 12:61975886-61975908 CATAAAAAGCAGAGGGGAGGAGG + Intronic
1097647722 12:62256856-62256878 GCTAAAAGGCAGTGGAAAGGCGG - Intronic
1097988705 12:65811419-65811441 CCTAACAGGCAGGGGAAAGAAGG + Intergenic
1098996733 12:77129127-77129149 CCTAGAAGGCAGAAGACAGAAGG - Intergenic
1099071166 12:78047536-78047558 CCTAAAAGCCAGAGGGAGTGAGG - Intronic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1099694868 12:86005580-86005602 CCTAGCAGGCCCAGGGAAGATGG + Intronic
1099958070 12:89370610-89370632 CCTAGAGGGAAGAGGGAGGAGGG - Intergenic
1100168413 12:91944892-91944914 ACTAAAAGACAGAGGCCAGAGGG - Intergenic
1100364368 12:93905512-93905534 TCAAAAAGGCAGGGGGAAAAAGG + Intergenic
1100857145 12:98767380-98767402 CCAAGAAAGCACAGGGAAGAGGG + Intronic
1101064207 12:101002488-101002510 CCCAAAAGGCTGGGGGGAGAAGG - Intronic
1101397354 12:104360093-104360115 CCAAAAAGACAAAGGGAAGAAGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102163507 12:110787940-110787962 CCCATAACGCAGAGGAAAGAAGG - Intergenic
1102527044 12:113519797-113519819 CCAGAAGGGCAGAGGGAAGGGGG - Intergenic
1102616040 12:114155064-114155086 CTTAAAAGGTATATGGAAGAAGG + Intergenic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1102975918 12:117207236-117207258 CCTAAATGGAAGAGGGCTGAGGG + Intergenic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1104048558 12:125181334-125181356 CCAAGAAGGAAGAGGGAAGAGGG + Intergenic
1104304000 12:127592879-127592901 CTGATAAGGCAAAGGGAAGATGG + Intergenic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107294251 13:38893211-38893233 CCTACAAGGCTGGGGGAAGTGGG + Intergenic
1107578724 13:41757589-41757611 GCTAAAGGGCAGAGAGAAGGAGG - Intronic
1107731834 13:43356463-43356485 CCTAGAAGCCAGGGAGAAGAAGG - Intronic
1108503404 13:51087898-51087920 CCAGGAAGGCAGTGGGAAGATGG - Intergenic
1108848842 13:54704209-54704231 CCTCAAAGGCAAAGGGAAACTGG - Intergenic
1108894829 13:55313126-55313148 ACTAGAAGGTAAAGGGAAGATGG - Intergenic
1109635351 13:65108233-65108255 CCTACAAGCCAGAAGGGAGATGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110820782 13:79913518-79913540 CCTAAAAGGCAAAGTTAAAAAGG - Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111670465 13:91323250-91323272 CCTAAACTGCAAAGGGAAGTCGG - Intergenic
1113203692 13:107893345-107893367 CCTCAAAGGCAAAGAGAAGCTGG + Intergenic
1113637051 13:111926845-111926867 CCCAACAGGCAAAGGAAAGAGGG + Intergenic
1113742890 13:112723637-112723659 CCCAAAAGGGAGGGGGTAGAAGG + Intronic
1113968026 13:114165663-114165685 CCTAAGAGGCAGAGTTTAGAAGG - Intergenic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115705588 14:35994749-35994771 CTTCAAAGGCAGTGGGCAGAAGG - Intergenic
1116737335 14:48708682-48708704 CCTAAAAGGCAAAGTGAAATAGG + Intergenic
1116908666 14:50433260-50433282 CTTAAAAGGCAGAGTGCAGGTGG + Intronic
1118846761 14:69553304-69553326 ACTAAAACTAAGAGGGAAGAAGG - Intergenic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1118912750 14:70075511-70075533 CCAACAAGGCAGAAGGCAGAAGG - Intronic
1119343069 14:73897303-73897325 CTTTAAAGGAACAGGGAAGAAGG + Intronic
1119535334 14:75398412-75398434 CAGAAAAGGAAAAGGGAAGAAGG + Intergenic
1119847635 14:77842416-77842438 CCTGAAAGATACAGGGAAGAAGG - Intronic
1119847837 14:77843906-77843928 CCTAAAAGGAAGGTGGCAGATGG - Intronic
1120459028 14:84769923-84769945 ACTAACAGGAATAGGGAAGAAGG - Intergenic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1121770706 14:96534378-96534400 CCAAGAAGGCAGAATGAAGAAGG + Intronic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1123630114 15:22255356-22255378 CCAAAAAGGCAGCGGGAAGTGGG + Intergenic
1123945789 15:25238292-25238314 ACTGAAAGACACAGGGAAGAAGG - Intergenic
1123963092 15:25427348-25427370 CCTATAAGATAGAAGGAAGATGG + Intronic
1124136282 15:27038743-27038765 CCAGAAAGGCAGAGGGTAGGGGG + Intronic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1125005728 15:34814624-34814646 GCTAAAAGGCAAATGGAATATGG + Intergenic
1125080657 15:35669134-35669156 GTTAAAAGGCAGAGACAAGAAGG - Intergenic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126342258 15:47654094-47654116 CCTAAAATGAAGAAGAAAGAAGG + Intronic
1126441696 15:48696768-48696790 CCTAGAAGGAAGATGGAAGCTGG - Intergenic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1127505240 15:59591662-59591684 CCAAAAAAGCAGAGGCTAGAAGG - Intergenic
1127642744 15:60931045-60931067 TTTAAATGGCAGGGGGAAGAGGG + Intronic
1127952538 15:63823483-63823505 CCTAACTGGTAGAAGGAAGAAGG + Intronic
1128259338 15:66221570-66221592 CTTAGAAGGCAGAGAGAAGTGGG + Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128923028 15:71629468-71629490 CCTGAAAGACACAGGGAACACGG - Intronic
1129331578 15:74830537-74830559 CCTGAAGGGTAGAGTGAAGATGG - Exonic
1129774682 15:78228753-78228775 ACTAAAAGCCAGTGGGAACAGGG - Intronic
1129784757 15:78302168-78302190 GCTAAAAGTTAGAGTGAAGATGG - Intergenic
1130196996 15:81789146-81789168 ACAAAAAGGCAGAGGAAGGAGGG - Intergenic
1130399674 15:83537780-83537802 CCTAGAAGACAGAGAGCAGATGG - Intronic
1130616512 15:85414042-85414064 CCTGAAAAGCAGAGGAAAAAAGG + Intronic
1130994887 15:88898140-88898162 GGTAGAAAGCAGAGGGAAGAGGG + Intergenic
1131052129 15:89355508-89355530 GCTTAAAGGCAGCTGGAAGATGG + Intergenic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131293620 15:91128650-91128672 ACAGAAAGGCAGAGGGAAGTGGG - Intronic
1131386766 15:92014551-92014573 GCTAAAAAGCAGTGGGAAAATGG + Intronic
1131915078 15:97256289-97256311 CCTTAAAGCCAAAGGGAAAAGGG - Intergenic
1132326751 15:100977036-100977058 TCTAAAAGGTAGAGAAAAGAAGG + Intronic
1133363465 16:5192431-5192453 CCTCCAAGGCAGAGTGAAGTGGG - Intergenic
1133435417 16:5775306-5775328 CTTGAAGGGAAGAGGGAAGAGGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135197468 16:20406148-20406170 TCTAATAGGCAGATGGAAAACGG - Intergenic
1135878144 16:26224843-26224865 CATAAAAGACAGAGGGAACATGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136476965 16:30519543-30519565 GCTAACAGGCAGAGGGGAGGAGG + Intronic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1138088399 16:54154587-54154609 CCTGAGAGGCATGGGGAAGAGGG + Intergenic
1140209656 16:72960194-72960216 CCTGAAGGGCAGAGGCAAGGGGG + Exonic
1140491446 16:75339646-75339668 CCTAAAGGGCAGAAGGCTGAGGG - Intronic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1140906529 16:79414025-79414047 CCTAAAAGGTACAGGAAGGATGG - Intergenic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141972979 16:87495299-87495321 CCAAAAAGGCAGCGGGAAGTGGG - Intergenic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1142519892 17:497488-497510 CCTACAAGGGAGCGGGGAGAGGG - Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1145815153 17:27789848-27789870 GATAAGAGGAAGAGGGAAGATGG - Intronic
1146370525 17:32263266-32263288 AATAAAAGGGAGAGGGAAGATGG - Intergenic
1146912947 17:36659790-36659812 AGTCAAAGGCAGACGGAAGAGGG + Intergenic
1147466256 17:40613467-40613489 CCCAAAAGGCAATGGGAACAGGG - Intergenic
1147613364 17:41813941-41813963 CCTAAAATGGAGAGAGATGAGGG - Intronic
1147919065 17:43905558-43905580 CCAGGAAGGCAAAGGGAAGAAGG - Intronic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148336969 17:46848452-46848474 CCCACAGGGCAGAGGGAAGGTGG + Intronic
1148513579 17:48194748-48194770 ATTAAAAGGAAGAGGGAGGATGG - Intronic
1149075402 17:52591916-52591938 ACTAAAAGGAAGATGGAAGGAGG - Intergenic
1149410733 17:56403992-56404014 CCTACAAGCCAGAAGGAATAGGG - Intronic
1149529077 17:57380503-57380525 CCTAACAGGGAGAGTGAAGCGGG + Intronic
1149744494 17:59082308-59082330 CCAAGATGGGAGAGGGAAGATGG - Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1151608096 17:75153349-75153371 CCCAAAAAGCAGTGGGAAGAAGG + Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1154060340 18:11054636-11054658 CCTAAAAGGCTGAGGAACCAAGG + Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155570380 18:27185483-27185505 CCAGAAAGTCAGAGGAAAGAGGG - Intergenic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1156521945 18:37729410-37729432 ACAAAAAGGCAGAGGAAAGGTGG + Intergenic
1156802614 18:41136091-41136113 CCTAAGAGAGACAGGGAAGAAGG + Intergenic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1159274681 18:66201498-66201520 TCTAAAAAGAAGAGGTAAGAAGG - Intergenic
1159424389 18:68265841-68265863 CCTAAAAGTCAGAGGCAAATTGG + Intergenic
1160388154 18:78510380-78510402 ACTTAAAGGCAAAGGGAGGAAGG + Intergenic
1160566018 18:79787187-79787209 CCTCAAATGCAGCGGGGAGACGG + Intergenic
1161474490 19:4476758-4476780 GCTAAAAGGCAGTGGAAGGATGG + Intronic
1161521247 19:4724532-4724554 TCTAAAAGGCAGGAGGAAGGCGG + Intronic
1162917003 19:13880116-13880138 CCAAAAGGACATAGGGAAGATGG + Intronic
1163202079 19:15776757-15776779 ACAAAAAGGCAGAGGAAAGGGGG + Intergenic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1164787544 19:30945521-30945543 GCAAAAAAGAAGAGGGAAGAGGG - Intergenic
1166256176 19:41606444-41606466 CCTGAAGGGCAGTGTGAAGAAGG + Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
1167856905 19:52249151-52249173 CCTAAACGGCAGTGGGATGATGG + Intergenic
1168056703 19:53868511-53868533 CCTGAAAGGCCGAGGGAGGGGGG + Intronic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
926866387 2:17363640-17363662 GGTAGAAGGCAGAGGGCAGAGGG - Intergenic
926888815 2:17621733-17621755 CCCAGAAGGCAGAGACAAGAGGG - Intronic
928241613 2:29591634-29591656 ACTAAAGGTCAGAGAGAAGAGGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929212917 2:39378123-39378145 CCTAAAAGAAAGAGGAAAAAAGG + Exonic
930055905 2:47251814-47251836 CCCAAAAAGTTGAGGGAAGATGG - Intergenic
930354446 2:50300033-50300055 AATAGAAGGTAGAGGGAAGAAGG + Intronic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
931108428 2:59083468-59083490 CCTGCAAGGTAAAGGGAAGATGG - Intergenic
931198453 2:60074851-60074873 CTTAAAAGGAAGAGAGAAAATGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932194257 2:69769554-69769576 TCTAAAAGGCAGGGGAAGGAGGG - Intronic
932293470 2:70604904-70604926 TCTAAAAGGGGGAGAGAAGAAGG - Intergenic
932398534 2:71464412-71464434 CCTGAAAGGGAGATGAAAGAGGG + Intronic
933531056 2:83512702-83512724 ACTAAAAGGCATAGCAAAGAGGG - Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
934148065 2:89115825-89115847 CCTAAGAGGCAGAGAGACAAAGG + Intergenic
934221220 2:90084784-90084806 CCTAAGAGGCAGAGAGACAAAGG - Intergenic
935605089 2:104963981-104964003 CCACAAATGCAGAGGGATGATGG - Intergenic
937768055 2:125685021-125685043 TCTAAAAGGTAGAAAGAAGAAGG + Intergenic
938949650 2:136244586-136244608 CTTACAAGGCACAGGGAAGGAGG + Intergenic
939314109 2:140524790-140524812 CCAAAAGGGGAGAGGGAGGAAGG + Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
941001711 2:160209121-160209143 CCAGACAGGCAAAGGGAAGAGGG + Intronic
941020066 2:160398239-160398261 CCTCAAAGGAATATGGAAGATGG - Intronic
941307052 2:163882929-163882951 CCTGAAAAGCAGTGGTAAGAAGG + Intergenic
941399734 2:165015783-165015805 TCTAAAATGCTGAGGTAAGAAGG - Intergenic
941853397 2:170206715-170206737 GGGAAAAGGGAGAGGGAAGAGGG - Intronic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
942770420 2:179511320-179511342 TCTAAATGGCAGATGGTAGATGG + Intronic
943197419 2:184771969-184771991 TCTCAAAGGGAGAGGGAATAGGG + Intronic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946025921 2:216671575-216671597 CTTACAAGGCAGTGGGAGGAGGG + Intergenic
946146620 2:217735835-217735857 TCTAAAAGGAAGGGAGAAGAGGG - Intronic
946291384 2:218748069-218748091 AACAAAAGGCAGAGGTAAGATGG - Intronic
947724330 2:232387858-232387880 CCAGAAAGGCGAAGGGAAGAGGG - Intergenic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948726736 2:239938790-239938812 CCCAAACGGCACAGAGAAGACGG + Intronic
948755198 2:240155380-240155402 CCAAAAAGTCAGAGGGAGGAGGG - Intergenic
1168840189 20:905089-905111 CCTAGAAGTCAGAAGGAAGCTGG - Intronic
1168975056 20:1958598-1958620 CTTATATGGCAGAGGGCAGAAGG - Intergenic
1170441741 20:16386291-16386313 TGGAAAGGGCAGAGGGAAGAGGG + Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1171308325 20:24124996-24125018 CCTGCAAGGCAGAGAGAAGTTGG + Intergenic
1172125701 20:32624023-32624045 CCTAACAGGCCAAGGGCAGAAGG - Intergenic
1172808053 20:37627324-37627346 CAGAAAAGGCAGGGGGGAGAGGG - Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173185173 20:40834908-40834930 CATAAAGGGCAGATGAAAGAGGG - Intergenic
1174118764 20:48246624-48246646 CCTAAAAGGCAGATTCCAGAGGG - Intergenic
1174316781 20:49709302-49709324 CATAAAGGCCAGAGGGTAGAGGG + Intronic
1174633931 20:51982628-51982650 CCTAAAAGATATAGAGAAGATGG + Intergenic
1175169145 20:57067764-57067786 AACAAAAGGCAGAGAGAAGAGGG - Intergenic
1175391228 20:58628640-58628662 CCTAGAAGTCAGAGGGATGCAGG - Intergenic
1175825620 20:61934983-61935005 CCGCAAAGGAAGATGGAAGACGG - Intronic
1176703124 21:10082573-10082595 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1178013968 21:28320643-28320665 ACCAAATGGCAGAGGGAAGTAGG - Intergenic
1178664302 21:34533320-34533342 CCTAACAGGCAGAGTGAGAATGG - Intronic
1179060741 21:37976676-37976698 CCTAAAAGGTTGAGAGCAGATGG + Intronic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
1181349188 22:22243347-22243369 CCAGAGAGGCAGTGGGAAGAAGG + Intergenic
1181477948 22:23180347-23180369 CCCAAAAGGCACAGGGACGGGGG + Exonic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182418978 22:30239490-30239512 CCAAATAGGCAGCGGGAGGAGGG + Intergenic
1182647415 22:31821557-31821579 GCTACAAGGCAGCGGGCAGAGGG + Exonic
1184046381 22:41975015-41975037 CCTAAAAGGCTGAGCGTAAATGG - Intergenic
1184162427 22:42704938-42704960 TCTAAAAGGGAGATGGCAGAAGG + Intronic
949323436 3:2837763-2837785 AGTAAAATGTAGAGGGAAGATGG + Intronic
949512081 3:4775191-4775213 GAGCAAAGGCAGAGGGAAGAGGG - Intronic
949579694 3:5375653-5375675 CCTAAAAGCCAGAAGAAAGTGGG - Intergenic
949884309 3:8681674-8681696 CCTAAGAGCCGGGGGGAAGAGGG - Intronic
951576685 3:24121717-24121739 CCTCAGAGTCAGAGGGAAAAAGG + Exonic
952011388 3:28904116-28904138 CTTAACAGACAGAGGCAAGATGG - Intergenic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
953129903 3:40127879-40127901 CCTCAAGGCCAGAGGGATGAGGG - Intronic
953251760 3:41250255-41250277 CCTGAAAGGCAGAGAAGAGAAGG + Intronic
954177003 3:48852609-48852631 CCTAGAAAGCACAGGGAAGCTGG + Intergenic
954581279 3:51704162-51704184 CCTAAAGGGCAGTGAGGAGAAGG - Exonic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
955243416 3:57201727-57201749 CCTAAGAGGCACAAGGCAGAAGG + Intronic
955349474 3:58183245-58183267 GCAAAAAGACACAGGGAAGAGGG + Intergenic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
955993192 3:64650509-64650531 GAGAAAAGGGAGAGGGAAGAGGG + Intronic
956044177 3:65177545-65177567 ACTCAAAGGTAGGGGGAAGAAGG - Intergenic
956468439 3:69541795-69541817 TCTAAAAGGCAGCGAAAAGAGGG - Intronic
956916832 3:73880766-73880788 GGTAAAAGGGAGAGAGAAGAAGG + Intergenic
958153642 3:89725137-89725159 TCTAAAAGACAAAGAGAAGAAGG + Intergenic
958437482 3:94114758-94114780 ACTAGAAGGGAGAGGGCAGAAGG - Intronic
958635113 3:96733938-96733960 CCAAAATAGCAGAGGGTAGATGG - Intergenic
958726185 3:97909076-97909098 CCTACAAGCCAGAGGGGAGTGGG - Intronic
959840524 3:110969326-110969348 TCCAAAAGGGAGAGGGAGGAAGG - Intergenic
960120946 3:113948139-113948161 CCAAAGAGGCGGAGGGGAGATGG - Exonic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
964120222 3:153175430-153175452 CCTAAAAGAGGGAGGGAAGCAGG - Intergenic
964975032 3:162607580-162607602 GTTAAAACACAGAGGGAAGAAGG - Intergenic
965063714 3:163816057-163816079 ACTAAAAGGAAGAGGGAAGTGGG + Intergenic
965090892 3:164161755-164161777 CCTAAAAGCCAGAAGACAGAGGG - Intergenic
966030746 3:175344493-175344515 CATAAAAGGCAAAGGGAAAGAGG - Intronic
966105818 3:176332639-176332661 CCTCAAAGGTAGAGAGAAGAAGG + Intergenic
966169218 3:177059099-177059121 ACTAAAAGGCAGACTGAAGGCGG + Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967598410 3:191355583-191355605 ACTGAAAGCCAGAAGGAAGAAGG - Intronic
968290781 3:197538054-197538076 CTTAAAAGGCAGAGAGAAGAAGG - Intronic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
969022579 4:4147899-4147921 CCTAAGAGCCAGGGGGGAGAGGG + Intergenic
970125957 4:12811529-12811551 CCAAAAAGGAAGAGTGAAGAAGG - Intergenic
970777096 4:19688171-19688193 CTGAAAAGGCACAGTGAAGATGG + Intergenic
970911264 4:21278743-21278765 CCCCAAGGGCAGAGGGGAGATGG + Intronic
972133075 4:35861201-35861223 CCTAAAAGGCAAAGAGAAACTGG + Intergenic
975103329 4:70539567-70539589 CCCAAAATGCAGAGGAAAGAAGG - Intergenic
975330667 4:73108809-73108831 GCTAAAAGGTTGAGGCAAGAGGG + Intronic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
978611605 4:110546756-110546778 CCTTAAAGGAAGTGAGAAGATGG + Intronic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
979857068 4:125646990-125647012 ACTAACAGACACAGGGAAGAAGG - Intergenic
979982920 4:127278169-127278191 CCAAAAAGGGAGAGTGAAGATGG - Intergenic
980375326 4:131938940-131938962 CCTACACTGCAGAGGGTAGAGGG + Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981496069 4:145394394-145394416 ACTAAAAGTCAGGGGGAAGCAGG + Intergenic
981827697 4:148962674-148962696 ACTAAATGGCAAAGGAAAGAAGG - Intergenic
981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG + Intergenic
982331361 4:154185192-154185214 CCTACATGGCAGAAGGCAGAGGG - Intergenic
983423337 4:167549200-167549222 TCTAAAATGCAGACGGAAAAGGG + Intergenic
984887368 4:184461978-184462000 CCTAGAAGGCAGACGGAGGCTGG - Intronic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
988326824 5:29779361-29779383 CCATAAAGGCAGAGAGAAGATGG + Intergenic
988624081 5:32852443-32852465 CCTAAAAGGGAGTGGGAAAATGG - Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
989342210 5:40388564-40388586 CCAATCAGGCAGAGAGAAGAAGG - Intergenic
989740954 5:44771281-44771303 TCTAAAATACTGAGGGAAGAAGG + Intergenic
990290031 5:54340707-54340729 CATAAAAGGAAGAGAAAAGAAGG - Intergenic
990537659 5:56738789-56738811 CCAAAAGGGGAGAGGGAGGAAGG - Intergenic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992695053 5:79277791-79277813 CCTAAAACACAGAAGCAAGAGGG - Intronic
992703147 5:79361156-79361178 CCTAGCAGCCAGAGTGAAGAGGG + Intergenic
992767111 5:80011444-80011466 ACTAAAAGGAAGAAGGGAGAAGG + Intronic
993598526 5:89890137-89890159 CCTAAAAGAGAGAGGGACAAGGG + Intergenic
993901378 5:93585776-93585798 CATCCAAGACAGAGGGAAGAAGG - Intronic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
995518377 5:112976545-112976567 CCTCAAAGGCGGCGGGAAGTTGG + Intergenic
995605082 5:113845520-113845542 CCTCAAAGGCACAGGGCTGAAGG - Intergenic
995807259 5:116067034-116067056 TCTGAAAGGCAGAGAGAAGGAGG - Intergenic
996010924 5:118480517-118480539 CCTAAAAGCCAGAAGGAAATGGG + Intergenic
997748839 5:136325452-136325474 CCTATAAGGAGGAGGGAGGAAGG - Intronic
998111668 5:139507292-139507314 CCTCAAAGGCAAAGAGAAGCAGG - Intergenic
998466949 5:142354183-142354205 CCTAGAAGGGAGAGTGAGGAGGG + Intergenic
998766442 5:145493079-145493101 AATAAAAGGCACATGGAAGAGGG - Intronic
999801743 5:155044823-155044845 CCTAAACTCCAAAGGGAAGAGGG - Intergenic
999985702 5:157003346-157003368 CCTGAAAGACAGAGGGCTGATGG - Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001303136 5:170552552-170552574 CATAACAGGTAGGGGGAAGATGG + Intronic
1001546999 5:172576450-172576472 TCCAAAGGGCAGAGGGAAGCAGG + Intergenic
1001858166 5:175030824-175030846 CCTAAAAGGTAGATGGTGGAAGG + Intergenic
1001942248 5:175749025-175749047 CCTAAAAAGTAGAGGGAATCTGG + Intergenic
1001958010 5:175861595-175861617 CCTAGAAGGGAGACGGCAGAGGG + Intronic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1003190979 6:3874281-3874303 CCCAAAAGTCAGAGTGCAGATGG + Intergenic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1004036061 6:11925214-11925236 CCTCAAAGGCAGTGGTCAGAGGG + Intergenic
1005008042 6:21309817-21309839 GCTGAAAGGCAGCGGGGAGAGGG - Intergenic
1005075677 6:21904070-21904092 CACCAAAGGCAGTGGGAAGATGG - Intergenic
1005929207 6:30469208-30469230 CCTCAAAGGAGGAGTGAAGATGG + Intergenic
1005943381 6:30578096-30578118 CCGAAAAGGCAGGCGGAAGAAGG + Exonic
1006054428 6:31372487-31372509 CCCAAAAGAGAGAAGGAAGAAGG + Intergenic
1006651021 6:35551650-35551672 GCCAGAGGGCAGAGGGAAGATGG + Intergenic
1007033037 6:38646383-38646405 TCTAAAAAGCAGATGGTAGAGGG - Intergenic
1007182364 6:39938813-39938835 GGTAGAAGGCAGAGGGAAGCAGG + Intergenic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007694001 6:43720109-43720131 CATCAAAGGCAGAGCGCAGAGGG + Intergenic
1008137750 6:47796356-47796378 CCTAACAGGCATAAGGAAAAAGG - Intronic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1008811088 6:55500120-55500142 CATAAAAGGGAGAGGGATGGTGG + Intronic
1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG + Intronic
1010651613 6:78462357-78462379 CCTATAAGCCATAGGGAAAAGGG + Intergenic
1011332563 6:86226669-86226691 CCTACAAGCCAGAAGGGAGAGGG - Intergenic
1011333852 6:86238329-86238351 CCTACAAGCCAGAAGGGAGAGGG + Intergenic
1011389757 6:86838806-86838828 CCAAACTGGCAGAAGGAAGAAGG - Intergenic
1011427990 6:87251426-87251448 CAGAAAAGGCAATGGGAAGAGGG + Intronic
1012392447 6:98757832-98757854 TATAAAAGGCAGAGTGGAGAAGG - Intergenic
1012760807 6:103298125-103298147 CTTAAAAGGGAGAGGCAGGAAGG - Intergenic
1014368642 6:120577378-120577400 CCTACAAGGGAAAGGGCAGATGG + Intergenic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1015288363 6:131509987-131510009 CCTAAATGGTAGAGGCAAAATGG + Intergenic
1015986574 6:138890350-138890372 CCTCAAAGGCACAGGGTAGCAGG + Intronic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016521488 6:144951566-144951588 CCTAAACTCCAAAGGGAAGAGGG - Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1018423400 6:163659825-163659847 CCTAAAAGGTAGAGGAGGGAAGG - Intergenic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1019131211 6:169877433-169877455 CTAAAAAGGAAGACGGAAGAAGG - Intergenic
1019652745 7:2169487-2169509 CCAAAAAGGCATAGGAAAAAAGG + Intronic
1020205856 7:6115183-6115205 CCTGAAATACAGGGGGAAGAGGG - Intronic
1020762697 7:12288199-12288221 ACTATAAGGCAGTGGGAGGAAGG + Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022858673 7:34342550-34342572 CCCAACTGGCAGAGGGAAAAAGG - Intergenic
1023246091 7:38205811-38205833 ATTAGAAGGCAGAGGGTAGAGGG - Intronic
1023494787 7:40783558-40783580 CATAAGAGTCAGAGGGGAGAAGG + Intronic
1023495145 7:40787517-40787539 ACTGAAAGACAGAGAGAAGAAGG + Intronic
1023644352 7:42293678-42293700 CCCAAACGGTAGGGGGAAGATGG - Intergenic
1023828372 7:44024756-44024778 CCCAAAAGCCATAGGGAAGAGGG + Intergenic
1024049057 7:45606580-45606602 ACTAAAAGTCAGAGGGAAGAAGG - Intronic
1024087780 7:45911003-45911025 AACAAAAGGCAGAGGAAAGAAGG - Intergenic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1025843688 7:65176254-65176276 CCCAAAAAGGAGAGAGAAGATGG - Intergenic
1025894083 7:65682876-65682898 CCCAAAAAGGAGAGAGAAGATGG - Intergenic
1025986314 7:66455620-66455642 CCTAACAGCCAGAGAGAATATGG + Intergenic
1026028616 7:66769042-66769064 CCTAACAGCCAGAGAGAATATGG - Intronic
1026583094 7:71634125-71634147 CCAAAAAGGGGGAGGGAAGGAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1029027779 7:97435578-97435600 GGAAAGAGGCAGAGGGAAGATGG + Intergenic
1029756672 7:102578203-102578225 CCCAAAAGCCACAGGGAAGAGGG + Intronic
1029774612 7:102677272-102677294 CCCAAAAGCCATAGGGAAGAGGG + Intergenic
1029909065 7:104124797-104124819 CTTGAAAGTAAGAGGGAAGAGGG + Intergenic
1030245316 7:107378805-107378827 CCTAAAAGTGACAGGGAAAATGG + Intronic
1030386397 7:108872527-108872549 CCTAAAAGAGGGAGGCAAGAAGG - Intergenic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1031389480 7:121195994-121196016 CCTAGAAGGCCGGGGGGAGATGG + Intronic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1033003901 7:137539134-137539156 CCTAAAATTAGGAGGGAAGAGGG + Intronic
1033032824 7:137844295-137844317 TCTCAAAGTCAGAGGAAAGATGG - Intronic
1034671000 7:152858465-152858487 CCTAAATTGAGGAGGGAAGAAGG + Intergenic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1034824729 7:154251380-154251402 CCTAAAAGACAGAGTCAACAAGG + Intronic
1034918653 7:155061049-155061071 AATAAAAGGCTGAGGGAAGTGGG - Intergenic
1035089259 7:156293175-156293197 GCTAAGAGTCAGAGAGAAGAGGG - Intergenic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036687554 8:10922018-10922040 CTTACATGGCAGAGGGCAGAAGG - Intronic
1036723108 8:11196320-11196342 CATAAAAGGCAAAGAGAAGTGGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037282133 8:17253318-17253340 AAGAAAAGGCAGAGGGAAAAAGG - Intronic
1037645297 8:20787408-20787430 CCTAGAGGGAAGTGGGAAGAGGG - Intergenic
1038062895 8:23931794-23931816 CCTAAAAAGAAGAGGGAACTGGG - Intergenic
1038685007 8:29708358-29708380 ACTAAAAGGTATAGAGAAGAAGG - Intergenic
1038972554 8:32652854-32652876 GTTAAAAGGAAGAGGGAAGGAGG - Intronic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039591714 8:38755594-38755616 CTGAAAAGGCTGAGGCAAGAGGG + Intronic
1039764800 8:40616950-40616972 TCTAATAGCCAGAGTGAAGAAGG + Intronic
1040577941 8:48670648-48670670 TCCAAGAGGCACAGGGAAGATGG - Intergenic
1040743526 8:50611261-50611283 ACTCAGAGGCAAAGGGAAGAAGG - Intronic
1040861414 8:52002901-52002923 CATAAAAAACAAAGGGAAGATGG - Intergenic
1040962996 8:53054270-53054292 CCCAAAAGGCAGAGAGAAGAAGG - Intergenic
1041014626 8:53579897-53579919 CAAAAAATGCAGAGGAAAGAGGG + Intergenic
1041281841 8:56218353-56218375 TCTAAAAGGCAGTGGGCATAAGG - Exonic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041478695 8:58294567-58294589 TCTAGAAGGCTGAGGCAAGAGGG - Intergenic
1041742843 8:61175614-61175636 ATTTAAAGGCACAGGGAAGAAGG + Intronic
1042014525 8:64293336-64293358 TCTGAGAGGCAGTGGGAAGAAGG - Intergenic
1042184443 8:66122725-66122747 TCTAAAAGGAAGAGGCTAGAAGG - Intergenic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1043524779 8:81084148-81084170 TCTGAAAGGTAGAGGAAAGATGG - Intronic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1046453856 8:114432962-114432984 AACAAAAGGCAGAGGGAAGCTGG + Intergenic
1047360789 8:124167045-124167067 CCTGGAAGGTAGAGAGAAGATGG - Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048214454 8:132481557-132481579 ACTAGAGGGAAGAGGGAAGAGGG - Intergenic
1048313244 8:133342483-133342505 ACAAAAAGGCAGAGGAAGGAGGG + Intergenic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1049741410 8:144242806-144242828 CCTGGACGGCAGTGGGAAGAAGG + Intronic
1051428905 9:16962205-16962227 TCTACAGGGCAGAGAGAAGAGGG - Intergenic
1051950152 9:22621412-22621434 ACTAAAATGCAGGGAGAAGACGG - Intergenic
1053399395 9:37804473-37804495 CTTAAAAGACAGAGGAAAAAGGG + Intronic
1053640383 9:40069606-40069628 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1053765752 9:41395867-41395889 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054321078 9:63665602-63665624 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1054544365 9:66307020-66307042 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1055037308 9:71831404-71831426 TCTAAAAGGGAGAGAGAAGATGG + Intergenic
1055372191 9:75611904-75611926 GATACAAGGCAGAGAGAAGAAGG + Intergenic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1055819469 9:80244592-80244614 GCTAAAAGGAAGAGGGAAATGGG - Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1056621894 9:88221590-88221612 CCAAAAAGGCTGAGGGCAGTGGG - Intergenic
1056720818 9:89070326-89070348 TCCAGAAGGGAGAGGGAAGAAGG - Intronic
1056954533 9:91071761-91071783 CAGAAAAGGCAGAGGGATGTGGG + Intergenic
1057540121 9:95959830-95959852 CCTAAAAGACAAAAGGAAGTTGG + Intronic
1057939311 9:99266937-99266959 GCTAGGAGGCAGAGGAAAGAAGG - Intergenic
1057941369 9:99288123-99288145 CCTCAAAGGAAAAGGGAAGGAGG + Intergenic
1058519338 9:105803293-105803315 CCTAATATCCAGAGGGGAGAAGG - Intergenic
1058600798 9:106667971-106667993 CCTAACAGTCAGAGCAAAGATGG + Intergenic
1058625749 9:106931266-106931288 AATAAAAGTCAGAGGGAAAAGGG - Intronic
1058744489 9:107976633-107976655 CATAAAAGGCGGATGGGAGAAGG + Intergenic
1059121653 9:111644802-111644824 CCCAAAAAGCAGAGGGAGAATGG + Intronic
1059901439 9:118930739-118930761 CCTAGGAGGCAGAAGGCAGAAGG - Intergenic
1059908148 9:119011653-119011675 CCTAAGGGGCACAGTGAAGAAGG + Intergenic
1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG + Intronic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061604432 9:131698237-131698259 CCTAACAAGCAAAGGGAGGAGGG + Intronic
1061825138 9:133253283-133253305 ACTAAAAGGTGGAGAGAAGAAGG + Intronic
1062203547 9:135321871-135321893 CTTCCAAGTCAGAGGGAAGATGG - Intergenic
1062356566 9:136167369-136167391 TCAAGAAGGCAGAGGGAAGATGG - Intergenic
1062483503 9:136763208-136763230 CCTAAAAGGCGGGGGGCGGAGGG + Intronic
1202788153 9_KI270719v1_random:52679-52701 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1185783798 X:2872174-2872196 CCTAAAAGCCTGACTGAAGATGG - Intronic
1185952174 X:4449477-4449499 CATTAAAGGAAGAGGGAAGTTGG + Intergenic
1186123484 X:6387472-6387494 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1187020219 X:15373757-15373779 GCTAAGAGGTAGAGGGAACATGG - Intronic
1187195536 X:17080204-17080226 GAGAAAAGGCAGAGAGAAGAAGG - Intronic
1187774162 X:22736610-22736632 ACTAAAAGGCAAATGAAAGAAGG + Intergenic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1188692535 X:33148309-33148331 GCTAAAAGCCAGTGAGAAGACGG + Intronic
1189442340 X:41048667-41048689 ACTGAAAGGCAGAGAGAAAAAGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189841931 X:45089069-45089091 CCTAAAAGGTAAATGGAAGGTGG - Intronic
1190156350 X:47996217-47996239 CATAAAGGGGAGAGGGAAAAGGG + Intronic
1191077137 X:56467400-56467422 CCTACAAGGCAGAAGGAATTAGG - Intergenic
1192334174 X:70203793-70203815 ACATAAAGACAGAGGGAAGAAGG + Intronic
1192536917 X:71936081-71936103 CCTATTTGACAGAGGGAAGATGG + Intergenic
1193201608 X:78697948-78697970 ACTAAAAGGAAGAGGGAAGATGG + Intergenic
1195413989 X:104600663-104600685 ACTAGAAGGCAGAGGGAATGGGG - Intronic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1195709948 X:107765739-107765761 CCAAAAAGGCAGAGGGGATAGGG + Intronic
1197539051 X:127731605-127731627 CCAACAAGGCAGAGGAAAAATGG - Intergenic
1198573202 X:137980507-137980529 CCAAACAGGCACAGTGAAGACGG - Intergenic
1198896321 X:141459593-141459615 CCTAAAGGGCAAAGGAAAAAAGG + Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1200411966 Y:2869737-2869759 CCTAAGAGACAGATGGAAGAAGG + Intronic
1200743096 Y:6876806-6876828 CCAAAAAGGGAGAGGAGAGAAGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1201527670 Y:14954281-14954303 CCTAAAAGGGACAGGGAAAATGG + Intergenic
1201605204 Y:15776497-15776519 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1201689821 Y:16751357-16751379 CCTACAAGGCAGAAGAAAGTAGG - Intergenic