ID: 912450309

View in Genome Browser
Species Human (GRCh38)
Location 1:109764151-109764173
Sequence AGGTGCCTACTCTGGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912450293_912450309 24 Left 912450293 1:109764104-109764126 CCCCACTGCTAGCCTTGGGGTGT 0: 1
1: 0
2: 0
3: 16
4: 139
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450292_912450309 25 Left 912450292 1:109764103-109764125 CCCCCACTGCTAGCCTTGGGGTG 0: 1
1: 0
2: 0
3: 11
4: 199
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450294_912450309 23 Left 912450294 1:109764105-109764127 CCCACTGCTAGCCTTGGGGTGTG 0: 1
1: 0
2: 2
3: 29
4: 294
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450295_912450309 22 Left 912450295 1:109764106-109764128 CCACTGCTAGCCTTGGGGTGTGG 0: 1
1: 0
2: 1
3: 29
4: 255
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450303_912450309 -10 Left 912450303 1:109764138-109764160 CCCTCTGCCTTTTAGGTGCCTAC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450302_912450309 -4 Left 912450302 1:109764132-109764154 CCTCTTCCCTCTGCCTTTTAGGT 0: 1
1: 0
2: 2
3: 55
4: 573
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450300_912450309 -3 Left 912450300 1:109764131-109764153 CCCTCTTCCCTCTGCCTTTTAGG 0: 1
1: 0
2: 5
3: 57
4: 544
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450298_912450309 -1 Left 912450298 1:109764129-109764151 CCCCCTCTTCCCTCTGCCTTTTA 0: 1
1: 0
2: 14
3: 145
4: 1082
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450299_912450309 -2 Left 912450299 1:109764130-109764152 CCCCTCTTCCCTCTGCCTTTTAG 0: 1
1: 0
2: 2
3: 67
4: 667
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172
912450297_912450309 12 Left 912450297 1:109764116-109764138 CCTTGGGGTGTGGCCCCCTCTTC 0: 1
1: 0
2: 2
3: 36
4: 342
Right 912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912450309 Original CRISPR AGGTGCCTACTCTGGGGAAC AGG Intronic
900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG + Intronic
900874754 1:5333909-5333931 AGGTGTCTACTGTGGACAACTGG + Intergenic
901019129 1:6247058-6247080 AGGTGCCAACCCTGGGGCAGGGG + Intergenic
902401112 1:16157227-16157249 TGGTGCCTACTCTTGGGAAGCGG + Intergenic
902824586 1:18964366-18964388 AGGTCCCTACCCTGGGTTACGGG - Intergenic
903060306 1:20664414-20664436 AGGTGGGCTCTCTGGGGAACAGG + Exonic
903118654 1:21198772-21198794 AGGTTCCTACTTTTGGGAAAGGG + Intergenic
903332216 1:22601953-22601975 AGGTGCCTGCCCTGGGGGACAGG - Exonic
904844301 1:33397276-33397298 AGGTGCTTAGTCCCGGGAACAGG + Intronic
906096683 1:43228853-43228875 AGGTGCCATCTATGAGGAACAGG - Intronic
906514321 1:46429844-46429866 AGTTGCCTTCACTGGGGAAATGG + Intergenic
909434584 1:75626048-75626070 ACATGCCTACTGTGGAGAACAGG + Intergenic
909606647 1:77514990-77515012 AGGTGGCCACTCTGGAGAAGTGG - Intronic
910225932 1:84936105-84936127 AGGTGCCTATTCTCTGTAACAGG + Intronic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
921996069 1:221419605-221419627 AGGAGCCAACACTGGGGATCTGG - Intergenic
922781656 1:228257245-228257267 AGGTGCCTCCCCTGGGAAAGTGG + Intronic
923188189 1:231594697-231594719 AAGGGCCTACTCTGGGGGACAGG - Intronic
923188394 1:231596377-231596399 AGGGGCCTACTCTGGGGGACAGG - Intronic
923295945 1:232595046-232595068 AGGTGCCCATTCGGAGGAACAGG + Intergenic
923447026 1:234081449-234081471 AGGTCCTGACTCTGGGAAACAGG - Intronic
923985108 1:239373052-239373074 TGGGGCCTACTCTGGGGTAAAGG - Intergenic
924456904 1:244226007-244226029 AGGAGGCTACTCTGTGGAAGGGG + Intergenic
1062922799 10:1292815-1292837 AGGAGCTTTCTCTGGAGAACAGG - Intronic
1067938621 10:50633307-50633329 AAATGCCTACTGTGGAGAACTGG - Intergenic
1068523847 10:58106099-58106121 TGGTGCCCACTCAGGGGGACCGG - Intergenic
1068579041 10:58718248-58718270 AGGTGCCACCTATGAGGAACAGG - Intronic
1069771577 10:70903749-70903771 AGTTGCCTCCTCTAGGGAGCTGG - Intergenic
1072780987 10:98251661-98251683 ATGTGCCAACTTTGGAGAACAGG - Exonic
1072790000 10:98311095-98311117 AGGTGGCTCCACGGGGGAACTGG + Intergenic
1072936085 10:99714933-99714955 CAGTGACTACTCTGGGGAACTGG - Intronic
1077161087 11:1113192-1113214 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161107 11:1113238-1113260 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161127 11:1113284-1113306 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161147 11:1113330-1113352 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161167 11:1113376-1113398 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161187 11:1113422-1113444 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077366230 11:2162416-2162438 AGGTGCCTGTTCTGGGGAGCTGG - Intergenic
1078734748 11:14009754-14009776 AGGTGCCATGTATGGGGAACAGG - Intronic
1080214493 11:29825824-29825846 AGGTCCCAGCTCTGGGGACCTGG - Intergenic
1080241055 11:30127693-30127715 AAGTGCCTACTCTTGTGAATAGG + Intergenic
1081738571 11:45422367-45422389 AGGAGGCAACTCTGGGGAGCGGG + Intergenic
1081858630 11:46319382-46319404 AGCTGCCTCCTCTGGGAAGCGGG + Intronic
1083511964 11:63217677-63217699 AGGTGCCTACAATGGCGAGCTGG + Exonic
1084569782 11:69952266-69952288 AGGTGCCTCATCTGGAGAACAGG + Intergenic
1085480655 11:76820304-76820326 AGGTCCCTAGTTTGGAGAACAGG + Intergenic
1086970470 11:93075393-93075415 AGGTGCCATCTCTGAGGAAGTGG + Intergenic
1089199231 11:116713845-116713867 AGGTGCCATCTATGAGGAACAGG - Intergenic
1091022791 11:132116059-132116081 CGGTGCCTAATCCAGGGAACTGG - Intronic
1091464756 12:674220-674242 AGGTGCCTACACAGGGTAGCTGG + Intergenic
1092966674 12:13650388-13650410 AGGTCCCTACTATGGGGACAGGG - Intronic
1093494911 12:19745353-19745375 AGCTGCCTACTCTCTGGAATTGG + Intergenic
1094709218 12:32944288-32944310 AAGAGCCTACTCTGGGGCATGGG + Intergenic
1114080845 14:19200567-19200589 AGGTGCCTGATCTGAGGACCAGG - Intergenic
1114150205 14:20030144-20030166 AGGTGACTACTGTGGGGGACAGG + Intergenic
1115143096 14:30196562-30196584 AGGCGCCATCTCTGAGGAACAGG + Intergenic
1117029426 14:51652603-51652625 AAGTGCCTAGTCTGCGGAGCCGG + Intronic
1118818800 14:69331384-69331406 AGCTGCCTGCTCTGGGGAGAAGG - Intronic
1119147112 14:72327275-72327297 AGCTGCCTTCTCTGTGGAGCAGG + Intronic
1119287477 14:73467341-73467363 AGTTGCCAACACTGGGGAACAGG + Intergenic
1121312790 14:92944204-92944226 AGGTGCCTCCTGTGGGGTGCAGG + Intronic
1122062112 14:99143085-99143107 AGGTCCCTGCACTGGGAAACTGG + Intergenic
1123000785 14:105293039-105293061 AGGTGCCTGCTCTTAGGAAACGG - Intronic
1123015461 14:105371880-105371902 AGGTGCCCTCTATGGGAAACGGG - Intronic
1124692784 15:31839297-31839319 CAGTGACTACTTTGGGGAACAGG + Intronic
1125217242 15:37289529-37289551 AGGTGCAATCTTTGGGGAACAGG - Intergenic
1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG + Intergenic
1127711552 15:61604144-61604166 AGGTGCCTACTGTGTGTATCAGG - Intergenic
1127872165 15:63082829-63082851 AGGTCCCTTCTCTAGGGAAAAGG + Intergenic
1128731624 15:70025340-70025362 AGGTGCCTACCCCCAGGAACTGG + Intergenic
1129688574 15:77700309-77700331 AGTTGCCTACTCTGGGAGAAGGG + Intronic
1131214521 15:90526232-90526254 AGGTGCCTATGCTGGTGAATTGG + Intergenic
1132061414 15:98695344-98695366 AGGTGCCCACTCTGGTGAGATGG + Intronic
1133573989 16:7069765-7069787 AAGTGCCCACTATGGGCAACTGG - Intronic
1134694648 16:16214530-16214552 CAGTGCCCACTCTGGGGACCAGG + Intronic
1134977186 16:18580107-18580129 CAGTGCCCACTCTGGGGACCAGG - Intergenic
1135507968 16:23055473-23055495 AGGTGCCATCTATGAGGAACAGG + Intergenic
1135687213 16:24507452-24507474 AGGTTACTGCTGTGGGGAACCGG + Intergenic
1137475803 16:48809583-48809605 AGGTGCCATCTATGAGGAACAGG - Intergenic
1138344544 16:56311945-56311967 TGGTGCCCACCCAGGGGAACCGG - Intronic
1139366585 16:66437447-66437469 ACGTGCCTAGTCTGGGCAAGGGG - Intronic
1139651018 16:68362053-68362075 AGAAGCCCATTCTGGGGAACGGG - Intronic
1140795605 16:78434702-78434724 AGGTCCCTAATCAGAGGAACGGG + Intronic
1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG + Intronic
1144488098 17:15684236-15684258 GGGTGTCTGCTCTGGGGGACAGG + Exonic
1145757597 17:27404045-27404067 AGGAGCCTCCTCTGGGCATCTGG - Intergenic
1146026598 17:29326894-29326916 AGGTGCCATTTCTGAGGAACAGG + Intergenic
1147124495 17:38356726-38356748 AGGTTTCTGTTCTGGGGAACTGG + Intronic
1147628846 17:41917515-41917537 AGGGGCGTGTTCTGGGGAACAGG - Intronic
1151084524 17:71365145-71365167 AGGTGCCTACTGTGGGAATGTGG + Intergenic
1151317814 17:73334859-73334881 AGGTGCCTACCCTGGGTGAGGGG - Exonic
1152918689 17:83054796-83054818 AGGTACCATCTCTGGGGAACAGG + Intergenic
1156048451 18:32903730-32903752 AGGTTTCTGCTCTGGGGAAATGG + Intergenic
1160148568 18:76383452-76383474 AGGTGCCTGGTGTGGGGAAGAGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161887570 19:7008667-7008689 ATTTGCCTGCTCTGGGAAACAGG - Intergenic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1163184949 19:15631179-15631201 AGGTGCCATCTATGAGGAACAGG + Intronic
1163786029 19:19275385-19275407 AGGTGCCAAGTGTGGGGACCAGG - Intergenic
1163978404 19:20874678-20874700 AGGTTCCTACTCTAGTGAACAGG - Intergenic
925540508 2:4961380-4961402 TGGTCCCTCCTCTGGGCAACAGG - Intergenic
926698170 2:15785027-15785049 AGGTGTCTGCTCAGGGGCACAGG + Intergenic
930202583 2:48559372-48559394 AGGTGCCATCTGTGAGGAACAGG - Intronic
931695471 2:64867565-64867587 AGTTGCCTACTCTGTAAAACTGG + Intergenic
932526500 2:72475501-72475523 AGGTGCCAACTGTGGAGGACAGG + Intronic
932565137 2:72901422-72901444 AGATGCCTACTATTGAGAACAGG - Intergenic
938653306 2:133406361-133406383 AGGGGGCTGCTCTGGAGAACTGG + Intronic
947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG + Intronic
948887797 2:240892739-240892761 ATGTGCCTCCTGTGGGGGACAGG - Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1174277183 20:49412624-49412646 AGGTGCTTACTCTGCTGAAGGGG - Intronic
1175600105 20:60266292-60266314 AGGTGCTTTCCCTGGCGAACAGG - Intergenic
1176020339 20:62959429-62959451 ATGAGCCTACTCTGGGGGTCTGG + Intronic
1178281662 21:31288414-31288436 AGGTGCCATCTGTGAGGAACAGG - Intronic
1179923676 21:44521184-44521206 AGCTGCCTCCTCCGGGGAACTGG + Intronic
1179979968 21:44890772-44890794 AGCTTCCTCCTCTGGGGAGCAGG - Intronic
1180499928 22:15922118-15922140 AGGTGCCTGATCTGAGGACCAGG + Intergenic
1182373278 22:29827306-29827328 GGGTGCTTTCTCTGGGGAAGTGG + Intronic
1185072085 22:48662002-48662024 GGGTGCCTACTTTGGGGAGATGG + Intronic
950613280 3:14139511-14139533 TGGGGCCAACTCTGGGGCACTGG + Intronic
951503324 3:23414825-23414847 AGGTGCCATCTGTGAGGAACAGG + Intronic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
960004311 3:112766464-112766486 AGGTGCCGTCTATGAGGAACAGG + Intronic
960670607 3:120152288-120152310 TGGTGCCTAATCTGGAGGACTGG + Intergenic
965525145 3:169708398-169708420 AGGTGCCATCTATGAGGAACAGG + Intergenic
969655994 4:8498922-8498944 GGGTACCTCCTCTGGGCAACTGG - Intergenic
970433747 4:16012999-16013021 AGGCGCACACTCTGGGGACCTGG + Intronic
970448943 4:16148239-16148261 AGGTTCCTACAGTGGGGAAGAGG + Intergenic
976161201 4:82201391-82201413 AGGTTCCTACCCTGGGGCAGAGG - Intergenic
985516441 5:347764-347786 AGGGACCCACTCTGGGAAACTGG + Intronic
985976358 5:3421256-3421278 TGGTGCCTGCTCTGGAGAATGGG - Intergenic
986314847 5:6579790-6579812 AATTGCCTGCTCTGTGGAACTGG - Intergenic
986961591 5:13219404-13219426 AGGTGCCACCTATGAGGAACAGG + Intergenic
988521662 5:31950987-31951009 AGGTGCCATCTATGAGGAACAGG - Intronic
992176157 5:74150719-74150741 AGATGACTACTCAGGGGAAGAGG + Intergenic
993629122 5:90262691-90262713 AGGTGGCTTCACTGGGAAACAGG + Intergenic
999192469 5:149758599-149758621 AGGTGCCATCTTTTGGGAACAGG + Intronic
999798864 5:155014156-155014178 AGGTGCATACACTGCGGAGCAGG + Exonic
1001718773 5:173839540-173839562 AGGTGCCTATTCTGGAGTTCAGG - Intergenic
1001761887 5:174214344-174214366 AGGTGTGTGCCCTGGGGAACAGG - Intronic
1001904506 5:175460719-175460741 AGGTCCCCACCCTGGGGAACTGG + Intergenic
1003055021 6:2810253-2810275 AGGTGTCTATCCTGGGGAACAGG + Intergenic
1004054557 6:12122451-12122473 GGATGCCCACTCTGGGGCACAGG - Exonic
1005572764 6:27161583-27161605 AGGTGCCTAGTTTGGGTAAGTGG + Intergenic
1005911731 6:30316169-30316191 AGGTGACTACCCTAAGGAACTGG + Intergenic
1006030151 6:31172017-31172039 AGCTGCCCCCTCTGGGGACCGGG - Intronic
1007203528 6:40131093-40131115 AGCTGCCAACTCTGAGGAAGTGG + Intergenic
1008711865 6:54237193-54237215 AGATGACCACTGTGGGGAACTGG + Intronic
1010566472 6:77420509-77420531 AAGTGCCAACTATGAGGAACAGG + Intergenic
1016073687 6:139771602-139771624 AGGTGCCTTCTCTACTGAACTGG - Intergenic
1016561095 6:145395903-145395925 AGGTGCCTAATCTGCCCAACAGG + Intergenic
1019845237 7:3492608-3492630 AGTTGGCTACGCTGAGGAACAGG - Intronic
1020110809 7:5446815-5446837 AGGGGGCTATTCTGGGGGACAGG + Intronic
1020211302 7:6159839-6159861 AGGTGCCTGTGCTGGGGACCGGG - Intronic
1022648230 7:32251392-32251414 AGGTGCCTGGTCTGGAAAACCGG - Intronic
1024083698 7:45876517-45876539 AGGAGGCAACTCTGGGGACCTGG - Intergenic
1025128833 7:56365171-56365193 AGGTCCCAACTCTGGGGCAGAGG - Intergenic
1027161650 7:75807003-75807025 AGGTGCCAACTCTGTGAAGCTGG + Intergenic
1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG + Intergenic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1031615283 7:123872436-123872458 ACGTGCCCACTGTGGGGAGCTGG - Intronic
1036165462 8:6428841-6428863 AGGAGCTGCCTCTGGGGAACAGG - Intronic
1037376381 8:18234432-18234454 AGGTGCCTACTGTAGGAAAAGGG + Intergenic
1037548666 8:19948632-19948654 AGGTGATTGCTGTGGGGAACCGG + Intronic
1039405783 8:37311356-37311378 ATGTGCGTAATCTGGAGAACAGG + Intergenic
1043367338 8:79548884-79548906 ATATGCCTACTCTGGAAAACCGG + Intergenic
1044271232 8:90246650-90246672 AGATGCCTACTCTAGGTAATGGG + Intergenic
1047617990 8:126579081-126579103 TGGTTCCTACCCTGGGGAAAGGG - Intergenic
1049318227 8:141981033-141981055 AGGTGCCTCCTCCGAGGAAGGGG + Intergenic
1049438316 8:142597817-142597839 GGGTGCCTACTATGGGGGAATGG + Intergenic
1049458471 8:142708375-142708397 AGGTGCCATCTATGAGGAACAGG - Intergenic
1058756964 9:108091605-108091627 AGGTAACTCCTCTGGGTAACTGG - Intergenic
1060933983 9:127505550-127505572 AGGCCCCTCCTCTGGGGAGCAGG + Exonic
1061612481 9:131756391-131756413 GGGAGCGTACTCTGGGAAACTGG - Intergenic
1062304561 9:135896932-135896954 AGGTGCCATCTATGAGGAACAGG + Intronic
1186729631 X:12395207-12395229 AGGAGGCTTCTCTGGGGCACTGG + Intronic
1187827044 X:23342074-23342096 AAGTGTCTACTGTGGGCAACTGG + Intronic
1188568243 X:31551214-31551236 AGATTACTAATCTGGGGAACTGG + Intronic
1189090010 X:38072030-38072052 AGCTGCCTACTCAAGGGAAAAGG - Exonic
1190430233 X:50371703-50371725 AGGTGCGTAATCTTGGGAATTGG - Exonic
1190886128 X:54532003-54532025 AGGAGTCTACCCTGGGGAAAAGG - Intronic
1191707010 X:64104369-64104391 AGAAGTCTACTTTGGGGAACTGG + Intergenic
1195356953 X:104048214-104048236 AGTTTCCTCCTCTGTGGAACAGG + Intergenic
1196119561 X:112035252-112035274 AGGTGGCTACTCTGGATATCAGG + Intronic
1197155565 X:123266411-123266433 AGGTTTCTACTTTGGGCAACTGG - Intronic
1197596041 X:128465187-128465209 AGGTGCCATCTATGAGGAACAGG + Intergenic
1198621925 X:138521999-138522021 AGGTGCCATCTATGGGGAAGAGG + Intergenic