ID: 912451679

View in Genome Browser
Species Human (GRCh38)
Location 1:109771012-109771034
Sequence CCACGGGTATGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912451662_912451679 28 Left 912451662 1:109770961-109770983 CCAGGAGCTGGCGGCACTGAGGC 0: 1
1: 0
2: 0
3: 34
4: 318
Right 912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 254
912451667_912451679 0 Left 912451667 1:109770989-109771011 CCTGGGCCAGGCCTGGCCAGCAG No data
Right 912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 254
912451668_912451679 -6 Left 912451668 1:109770995-109771017 CCAGGCCTGGCCAGCAGCCACGG 0: 1
1: 0
2: 6
3: 53
4: 1063
Right 912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912451679 Original CRISPR CCACGGGTATGGAGGGGAGA GGG Intronic
900031150 1:373965-373987 AGACGGGGATGGAGGGGGGATGG - Intergenic
900366378 1:2313520-2313542 CCAGGGGTGTGGAGGGTCGAGGG + Intergenic
900385323 1:2407955-2407977 CAACGGCTGTGGAGGGGAGAAGG + Intronic
901351236 1:8598690-8598712 TCTCTGGCATGGAGGGGAGAGGG - Intronic
902115702 1:14119216-14119238 CCATGGGTCTGTAGGGGAGCAGG + Intergenic
902570973 1:17346808-17346830 TCACCGGTATGGATTGGAGATGG - Intronic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
903649046 1:24911967-24911989 CCACTGCCAGGGAGGGGAGAGGG + Intronic
904795762 1:33055268-33055290 CCTATGGCATGGAGGGGAGATGG + Intronic
905345729 1:37309819-37309841 CAAAGGGTAGGGAGAGGAGAGGG - Intergenic
905484117 1:38283756-38283778 GCACAGGGATGGACGGGAGACGG - Intergenic
905977218 1:42184943-42184965 GCACAGGCGTGGAGGGGAGAAGG + Intronic
906531311 1:46525571-46525593 CCAAGGGGCTGGAGGTGAGATGG - Intergenic
906922429 1:50078808-50078830 GCACGGGAATGGAGAAGAGAGGG - Intronic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
911230636 1:95357646-95357668 CCATGAGTCTGGAGGGGACATGG + Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
918095371 1:181329944-181329966 CCAAGGGAGTGGAGGGGAGTAGG + Intergenic
920186228 1:204161142-204161164 CCACTGACATGTAGGGGAGAGGG - Intronic
920708813 1:208275628-208275650 GCACAGGAATGGAGGGAAGAAGG - Intergenic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922854337 1:228761163-228761185 GCAGGGGGAGGGAGGGGAGACGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063664215 10:8051902-8051924 CCACGGGGAAGGAAGGGGGAAGG - Intergenic
1065368426 10:24957000-24957022 CCACGGATTTTGAGGGGGGATGG - Intergenic
1066022598 10:31318960-31318982 CCTCAGGTGTGGTGGGGAGAGGG - Intronic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066288635 10:33993143-33993165 CCAAGGGTGTGGAAGAGAGAAGG + Intergenic
1067188198 10:44047890-44047912 GCACGGGCGTGAAGGGGAGATGG - Intergenic
1067469023 10:46523066-46523088 TCAAGGGTATGGTGGTGAGAAGG - Intergenic
1067908597 10:50320717-50320739 CAACGGGTATGGAAGGGAATTGG - Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069071321 10:63993223-63993245 GCAGGGTTAGGGAGGGGAGATGG + Intergenic
1069592748 10:69652208-69652230 CCTCGGGTATGGGGGGCACAGGG - Intergenic
1070468901 10:76757482-76757504 ACACCGGCAGGGAGGGGAGAGGG + Intergenic
1070795835 10:79215775-79215797 CCCAGGGCATGGAAGGGAGATGG + Intronic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1073637065 10:105210088-105210110 CAACAGGAATGAAGGGGAGAGGG - Intronic
1075761021 10:124856768-124856790 CCTCAGGAAGGGAGGGGAGAGGG - Intergenic
1076014640 10:127018019-127018041 CCAGGGGTATCCTGGGGAGAGGG - Intronic
1076274126 10:129182235-129182257 CCAGGGGAAGGGAAGGGAGAGGG - Intergenic
1077535059 11:3120095-3120117 CCCCGGGTTAGGAGGGGTGAGGG + Intronic
1078368070 11:10722756-10722778 CCACTGGCATGGTGGGAAGATGG - Intergenic
1080441829 11:32301624-32301646 CCAGGGGAATGGAGGGGCAAGGG + Intergenic
1083267979 11:61555661-61555683 CCACGCCCATGGAGGGGAGCGGG + Intronic
1083335600 11:61920006-61920028 CCTGGGGCATGGAGGGGAGGGGG - Intronic
1083967029 11:66049261-66049283 CCACGAGCAAGTAGGGGAGAGGG + Intergenic
1085507864 11:77070321-77070343 CCCCGGGGATGGTGGGCAGAAGG + Intronic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1088848612 11:113687890-113687912 ACAGGGGCAGGGAGGGGAGAGGG + Exonic
1089565581 11:119369517-119369539 CCACGGGGTTGGTGGGGAGGGGG + Intronic
1090080355 11:123608528-123608550 ACAAGGGTATGGAGAGGACACGG - Intronic
1090386369 11:126359748-126359770 CCACGGGGAAGGAGGGAAGGAGG - Intronic
1094672896 12:32588077-32588099 CCACAGGGATGGAGGGGAATGGG + Intronic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1097956404 12:65490311-65490333 CCAGGGGTAGGGAGTGGAGGTGG + Intergenic
1098659274 12:73072451-73072473 CCACCAGCATGGAGGGGACAGGG + Intergenic
1100823624 12:98454986-98455008 CCACGAGTCTGGAGGGCAGCTGG - Intergenic
1101345039 12:103878964-103878986 CAAGGGGTAAGCAGGGGAGAAGG - Intergenic
1101513081 12:105410194-105410216 CCACGGACATTGAGGGGAGGGGG - Intergenic
1102467631 12:113139175-113139197 TCACAGGCATGGAGGAGAGAGGG + Intergenic
1102952855 12:117041871-117041893 CCACTGGTCAGGAGGGGACATGG - Intronic
1104743010 12:131192845-131192867 CCAGGGATAGGGAGGGGGGAAGG - Intergenic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1107226772 13:38059566-38059588 GCACAGGTAGAGAGGGGAGAGGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1113628950 13:111867154-111867176 CCACGGGTCTGGAGGTGGGTGGG - Intergenic
1115291180 14:31774820-31774842 CAACCTCTATGGAGGGGAGAGGG - Intronic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1117466168 14:55996627-55996649 CCAGAGGTATGAAGAGGAGATGG - Intergenic
1118030431 14:61812925-61812947 CCAAGGGTGAGGAGCGGAGAGGG - Intergenic
1118311431 14:64696397-64696419 CCACAGGGATGCAGGGGAGGGGG + Intergenic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1119197551 14:72728408-72728430 CCAATGGCATGGAGGGAAGAAGG + Intronic
1121108548 14:91296509-91296531 CCACGGGGGTGGAGGCGGGATGG - Intronic
1122375781 14:101256093-101256115 CCACGAGTATGGTGGGGATGAGG - Intergenic
1124026500 15:25971559-25971581 CCACAGATATGGAGGGCTGACGG - Intergenic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125531418 15:40415957-40415979 GCAGGGGCATGGAGAGGAGATGG - Intronic
1126674168 15:51144912-51144934 ACAAAGGTCTGGAGGGGAGAAGG + Intergenic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1127365331 15:58284247-58284269 GTACGGGGATGGAGTGGAGAAGG + Intronic
1127657746 15:61071561-61071583 GGAGGGGTAGGGAGGGGAGAGGG + Intronic
1127972422 15:63971850-63971872 TCAGGCATATGGAGGGGAGAGGG - Intronic
1128577191 15:68784226-68784248 CCAAAGCTATGGAGGGGAGTAGG - Intronic
1129314115 15:74730926-74730948 CCAGGGGTGTGGAGAGGTGAGGG - Intergenic
1129788484 15:78324495-78324517 GCACTGGGATGGAGAGGAGAGGG + Intergenic
1129875343 15:78971778-78971800 GGACGGGTATGGAGGGGACAGGG + Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1131369157 15:91865367-91865389 ACATGGGCTTGGAGGGGAGAGGG + Intronic
1132279694 15:100602441-100602463 CCGGGGGTAAGGAGGAGAGAAGG + Intronic
1132674130 16:1114673-1114695 CCCCGGGTGTGGAGCGGAGGTGG - Intergenic
1135815984 16:25634171-25634193 CCACGGGTAAGCAGGGGCTATGG + Intergenic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136109199 16:28054108-28054130 CCACGGGGGAGGAGGGGAGGAGG - Intronic
1136372697 16:29846146-29846168 CCACGGCCATGCTGGGGAGAAGG - Exonic
1138684319 16:58711387-58711409 CCATGGGAATGGAGTGGAAAGGG - Intronic
1140988879 16:80188751-80188773 GCACGGATCTGGAGGTGAGAGGG - Intergenic
1141697665 16:85627859-85627881 ACACAGGGATGGCGGGGAGAGGG - Intronic
1142137577 16:88458703-88458725 CCACGGGTATGGTGGCCAGGTGG - Intronic
1142611653 17:1111778-1111800 CCACTGGCCTGGAAGGGAGAAGG - Intronic
1142986377 17:3697464-3697486 CCAGGGGTAGGGAGAGGAGCAGG - Intergenic
1144709083 17:17388586-17388608 CCTCGGGGATTTAGGGGAGATGG + Intergenic
1145912789 17:28552290-28552312 CCGCGGGTGGGAAGGGGAGAGGG - Intronic
1146725119 17:35150031-35150053 CGATGGCTATCGAGGGGAGACGG - Exonic
1147228235 17:38997686-38997708 GCAGGGGAAGGGAGGGGAGAAGG - Intergenic
1147370114 17:39986757-39986779 CAAGGGGTTTGGCGGGGAGATGG + Intronic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150227904 17:63533758-63533780 CCACGGCTCTGGTGGGCAGAGGG - Intronic
1151562385 17:74877672-74877694 CCAGGGGAAGTGAGGGGAGAAGG - Exonic
1151694153 17:75705589-75705611 CCTGGGGTTTGGAAGGGAGAGGG - Intronic
1152418012 17:80175601-80175623 CCAAGGGGATGGAAGGGAGGAGG + Intronic
1152586879 17:81193168-81193190 CCACGGGCATGGAGGGCGGGAGG + Intronic
1152948503 17:83211748-83211770 AGACGGGGATGGAGGGGGGATGG + Intergenic
1153340420 18:3967566-3967588 CCACTGGTAAGGAGGAGAGCAGG + Intronic
1155395128 18:25378810-25378832 CCACAGGTCTGGTGGGGGGAGGG - Intergenic
1159390728 18:67789001-67789023 CCACAGGAATGCAGGGGACAGGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160734985 19:658308-658330 CCAGGCGCATGGAGGGGAGTGGG + Intronic
1160881309 19:1322034-1322056 CCAGTGGTATGGGGGTGAGACGG - Intergenic
1161129826 19:2581304-2581326 CCGCGGGGGTGGAGGGGTGATGG + Intronic
1162207394 19:9065891-9065913 CCATGGGCATTGAGGGGAGCGGG + Intergenic
1162802244 19:13118104-13118126 CCAGGGGCATAGAGAGGAGACGG + Intronic
1162821188 19:13224650-13224672 CCAAGGGTAAGGAAGGGACAGGG - Exonic
1163187978 19:15653005-15653027 CCCCAGGTAGGGAGGGGAGAAGG + Intronic
1163250805 19:16125288-16125310 CCACAGGGATGGAGAGGAGGGGG + Intronic
1163364327 19:16867781-16867803 CCACGGGAAGGGAGGTGGGAGGG - Intronic
1163691162 19:18739204-18739226 CCATGGGGATGGTGTGGAGATGG + Intronic
1164813221 19:31174759-31174781 ACATTGGTATGGAGGGGAGAGGG + Intergenic
1165774658 19:38397458-38397480 CCTCTGGTATGGAGGGATGAAGG - Intergenic
1165824350 19:38697281-38697303 CCACTGGTATGCAGGGAAAATGG - Intronic
1166314240 19:41979950-41979972 CCACGGGCATGGAGAGGACTTGG - Intronic
1168020665 19:53606621-53606643 CCAAGGGGATGGAGCGGTGAGGG + Intergenic
1168183567 19:54681566-54681588 GCAGGGGTAGGGAGAGGAGAGGG + Intronic
1168638400 19:58013770-58013792 ACACGGTAATGGTGGGGAGAGGG + Intergenic
925056364 2:860557-860579 CCAGTGCCATGGAGGGGAGAGGG - Intergenic
925091776 2:1162269-1162291 CCTCGGGTATGGAGGTGGGCAGG + Intronic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925608973 2:5687907-5687929 CCAAGGGCTTGGAGGGGTGAAGG + Intergenic
925981249 2:9179146-9179168 CCACGGGTGTGCCGGGGAGGCGG - Intergenic
927096379 2:19750495-19750517 CCACCGGGATGCAGAGGAGAAGG + Intergenic
927244658 2:20947766-20947788 CCAGGGGAATGGGGGTGAGAGGG - Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928317501 2:30257480-30257502 CCACCACTATGGAGGGCAGACGG - Exonic
929420550 2:41785621-41785643 TCAGGGGTATGCAGGGGTGAGGG - Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
937246804 2:120498985-120499007 CCATGGGGTTGGAGGGGTGAAGG + Intergenic
937905337 2:127050228-127050250 CCAAGGGAAGGGAGAGGAGAGGG + Intronic
938743139 2:134251896-134251918 CCAGGGGTGGGGAGGAGAGAGGG - Intronic
942428015 2:175879841-175879863 CCACAGCTATGAAGGGCAGACGG + Intergenic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
945255901 2:207802894-207802916 CCAGGGGTGGGGAGGGGAAATGG - Intergenic
947593129 2:231396137-231396159 TCAGGGGTCTGGAAGGGAGAGGG - Intronic
948094103 2:235320024-235320046 CCTGGGGTAGAGAGGGGAGAGGG - Intergenic
948165385 2:235857332-235857354 CCACGGATAGGGAGGAGGGATGG - Intronic
949031539 2:241799551-241799573 CCACAGGCAGGCAGGGGAGAGGG - Intronic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1173414974 20:42847199-42847221 CCACGGGGATGGAAGGGATTAGG + Intronic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1179916415 21:44480887-44480909 CCACGCGCATGCAGGGGCGATGG + Intergenic
1180959492 22:19756163-19756185 CCACGTGTGTGCAGGGGAGGCGG + Intergenic
1181558285 22:23684695-23684717 GCACGGGTAGGGAGGGGACAGGG - Intergenic
1181741470 22:24924872-24924894 CCAGGGGTATGGTTGGGGGATGG - Exonic
1182107932 22:27702505-27702527 CCAGGAGTATGGATGGGGGAGGG + Intergenic
1183358030 22:37369819-37369841 CCACAGGGAGGGAGGGGAGATGG - Exonic
1183361286 22:37384629-37384651 CCAGGGGTCGGGTGGGGAGAAGG - Intronic
1183478535 22:38050466-38050488 CCAGGGGGATGGGGAGGAGAGGG - Intergenic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184695206 22:46135135-46135157 TCACTGGTGTGGAGGGCAGAGGG + Intergenic
1184955994 22:47886262-47886284 GCAAGGGGATGGATGGGAGAGGG + Intergenic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
949461831 3:4302800-4302822 GCAGGGGTTTGGAGGGGTGAGGG + Intronic
950457872 3:13103369-13103391 CCACAGAGGTGGAGGGGAGAGGG - Intergenic
950694083 3:14684109-14684131 CCTAGGGTATGCAGGGGTGAGGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952323201 3:32296962-32296984 ACACGGGGAGGGAGTGGAGAAGG - Intronic
954515852 3:51175718-51175740 CCAGGGGTATAGATGGGAGTGGG + Intronic
955192207 3:56771850-56771872 CCACTGGGATGGAGAGGAAAGGG + Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
956046252 3:65199255-65199277 CCAGGGAGATGGAGGGGCGATGG + Intergenic
956580459 3:70806694-70806716 CCTCGTGTGTGGAGGAGAGAAGG + Intergenic
961578149 3:127855471-127855493 CCAGGGCTAGGGTGGGGAGAGGG - Intergenic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
966979875 3:185122319-185122341 CCACGGATATGGAGGGCCAATGG - Intronic
970569184 4:17362865-17362887 CCACAGGTAGAGGGGGGAGAAGG - Intergenic
971184061 4:24356885-24356907 CCCAGGGTATGGAGGGGAATTGG - Intergenic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
974036443 4:56821909-56821931 CCATGGGGAAGGAGGGGCGAGGG + Intergenic
974625913 4:64429067-64429089 CCAAGGTTATACAGGGGAGAGGG - Intergenic
981005447 4:139870292-139870314 CCAGGGGTAGGGTGGGGTGAGGG - Intronic
984157974 4:176215026-176215048 CCAGGGGTAAGTGGGGGAGAGGG + Exonic
985546459 5:512092-512114 CCACGGGTTAGGGGGAGAGAGGG + Intronic
986016437 5:3761521-3761543 CCACGGAGATGGAGGGAGGAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
989125536 5:38049097-38049119 CCTTGGGTATGCAGGGGAGTGGG + Intergenic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
993907265 5:93637082-93637104 CCAAGGGTAAGGAGGGGAGCTGG - Intronic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
997953928 5:138263953-138263975 CAGCGGGTATGGACAGGAGATGG - Intronic
999119807 5:149200509-149200531 CCACGGGCCTGGAGGGAAGTGGG + Intronic
1002419797 5:179139597-179139619 CCACGGGCATGGAGGAGAGGAGG - Intronic
1002742670 5:181444903-181444925 AGACGGGGATGGAGGGGGGATGG + Intergenic
1004978674 6:20997529-20997551 CCACGGGGGTGGCGGGGGGAGGG + Intronic
1006284323 6:33081226-33081248 ACAAGGGTATGGTGTGGAGATGG + Intronic
1006437784 6:34035208-34035230 CCAGGCTTATGGAGGGGGGAAGG + Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007693872 6:43719524-43719546 CCCTGGGAATGGTGGGGAGATGG + Intergenic
1008507897 6:52248512-52248534 GCACAGGCATGGAGGGGAGCAGG - Intergenic
1011348358 6:86396131-86396153 CCACAGGTATGAAGAGGAGCTGG + Intergenic
1013166046 6:107593176-107593198 GCACGGGAAAGGAGGGGAGATGG - Intronic
1017088667 6:150738699-150738721 CCACGGCTGGGGAGGGGACAGGG - Intronic
1017775716 6:157679353-157679375 CCAGGGTCATGGAGGAGAGAAGG - Intergenic
1018619414 6:165715542-165715564 CCAAGGGAATGAAGGGGAGAAGG + Intronic
1018937175 6:168281104-168281126 CCACGGGTGGGGAGGGAAGGCGG + Intergenic
1019247805 6:170720642-170720664 AGACGGGGATGGAGGGGGGATGG + Intergenic
1019453941 7:1114818-1114840 CCACGGGGCAGGAGGGGAGGTGG + Intronic
1019727134 7:2609264-2609286 CCACTGGTATAGAGGGCAGGAGG - Intronic
1019797302 7:3060342-3060364 CTAGGGGTAGGGAGGGGTGACGG - Intergenic
1023473578 7:40552293-40552315 ACAGAGGTATGGAGGGCAGAGGG - Intronic
1024291005 7:47803973-47803995 CCCCTGGTAGGGAGGGGAGAAGG - Intronic
1025146952 7:56513550-56513572 CCATTGGAATGGAGGAGAGATGG - Intergenic
1025985063 7:66442774-66442796 CAAACGCTATGGAGGGGAGAGGG + Intergenic
1027802656 7:82774901-82774923 CCAGGGGTTTAGCGGGGAGAAGG - Intronic
1029047298 7:97643899-97643921 CAATGGGCATGGAGGGGGGAAGG + Intergenic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1031866117 7:127039959-127039981 GAAGGGGTATGGAGGGGAAAGGG + Intronic
1033063877 7:138134364-138134386 CCACCTCTAGGGAGGGGAGAGGG + Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1035500312 8:87222-87244 AGACGGGGATGGAGGGGGGATGG - Intergenic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035706357 8:1678447-1678469 CCAGGGGTCTGGAGGGGGCAGGG - Exonic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039468715 8:37800923-37800945 CCATGGGAATGTGGGGGAGATGG - Intronic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1042816477 8:72882986-72883008 CCCCGGGAATGGAGGGGAAGTGG - Intronic
1044051994 8:87516494-87516516 CCAAGGGTAAGGAGGGGACTGGG - Intronic
1044320720 8:90797978-90798000 CCACAGTTCTGGAGGTGAGAAGG + Intronic
1044771582 8:95641194-95641216 CCACAGCTGTGGAGGGCAGAGGG - Intergenic
1049452634 8:142670189-142670211 GCGCGGGCAGGGAGGGGAGAGGG + Intronic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1050834015 9:10052840-10052862 CCATAGGAATGGAGGTGAGATGG - Intronic
1056376969 9:86024283-86024305 GCACAGGCTTGGAGGGGAGAGGG + Intergenic
1056505869 9:87257716-87257738 CCACAGGGATGGTGGGGTGAGGG + Intergenic
1057365236 9:94414258-94414280 CCACAAGTTTGGAGGGGACAGGG + Intronic
1057658085 9:96973826-96973848 CCACAAGTTTGGAGGGGACAGGG - Intronic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1060341425 9:122780107-122780129 CGAAGGGAATGGAAGGGAGAAGG - Intergenic
1060987262 9:127826854-127826876 CCCCAGGTATGCAAGGGAGAAGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062005030 9:134234793-134234815 CCAAGGGTATGGCGGGAAGAGGG - Intergenic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1062617172 9:137403149-137403171 ACACTGCCATGGAGGGGAGAGGG - Intronic
1203608577 Un_KI270748v1:76122-76144 AGACGGGGATGGAGGGGGGATGG + Intergenic
1189506241 X:41614211-41614233 CCACAGGTTAGGAGGGGATAGGG - Intronic
1189847242 X:45149012-45149034 CGACTGGTCTGGAGGAGAGAAGG + Exonic
1189992321 X:46607063-46607085 CCACGAGTCTGGAGGGCAGCCGG - Exonic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190521774 X:51286447-51286469 CCAGGGGTTTGGAGATGAGAGGG - Intergenic
1194706052 X:97177126-97177148 CCATGGATATGGAGGGTGGAGGG + Intronic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1197809278 X:130427197-130427219 GCAGGGGTCTGGCGGGGAGAAGG + Intergenic
1198383474 X:136105530-136105552 CCAGGCAGATGGAGGGGAGAAGG + Intergenic
1199942654 X:152640224-152640246 CCATGGGGAGGGAGGGGAGCAGG + Intronic
1201188976 Y:11430361-11430383 CCACGGGGACTGGGGGGAGAGGG - Intergenic
1202057034 Y:20845261-20845283 CCAGAGGTATGAAGAGGAGATGG - Intergenic