ID: 912453171

View in Genome Browser
Species Human (GRCh38)
Location 1:109779930-109779952
Sequence CAGGGCCACCTGGAGCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912453171_912453174 -5 Left 912453171 1:109779930-109779952 CCTCAGAGCTCCAGGTGGCCCTG No data
Right 912453174 1:109779948-109779970 CCCTGCCCCCATAGCTTTGCTGG No data
912453171_912453181 23 Left 912453171 1:109779930-109779952 CCTCAGAGCTCCAGGTGGCCCTG No data
Right 912453181 1:109779976-109779998 GCCTATGTTCCATCTCTCACAGG No data
912453171_912453176 -4 Left 912453171 1:109779930-109779952 CCTCAGAGCTCCAGGTGGCCCTG No data
Right 912453176 1:109779949-109779971 CCTGCCCCCATAGCTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912453171 Original CRISPR CAGGGCCACCTGGAGCTCTG AGG (reversed) Intergenic
No off target data available for this crispr