ID: 912455611

View in Genome Browser
Species Human (GRCh38)
Location 1:109794829-109794851
Sequence CTGCCTCCTCATCTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912455611_912455612 -10 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455612 1:109794842-109794864 GAGGAGGCAGCCGCTCAGACCGG No data
912455611_912455616 1 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455616 1:109794853-109794875 CGCTCAGACCGGGGAGTCACTGG No data
912455611_912455619 24 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455619 1:109794876-109794898 CTGCGCTCACAGGTGCTCACAGG No data
912455611_912455618 14 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455618 1:109794866-109794888 GAGTCACTGGCTGCGCTCACAGG No data
912455611_912455614 -8 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455614 1:109794844-109794866 GGAGGCAGCCGCTCAGACCGGGG No data
912455611_912455613 -9 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455613 1:109794843-109794865 AGGAGGCAGCCGCTCAGACCGGG No data
912455611_912455620 28 Left 912455611 1:109794829-109794851 CCAGGCTGCAGATGAGGAGGCAG No data
Right 912455620 1:109794880-109794902 GCTCACAGGTGCTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912455611 Original CRISPR CTGCCTCCTCATCTGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr