ID: 912456164

View in Genome Browser
Species Human (GRCh38)
Location 1:109798954-109798976
Sequence ATGCAATACACTTCTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912456156_912456164 17 Left 912456156 1:109798914-109798936 CCTCTGGCCACCAAACATCTATG No data
Right 912456164 1:109798954-109798976 ATGCAATACACTTCTCCTAGGGG No data
912456157_912456164 10 Left 912456157 1:109798921-109798943 CCACCAAACATCTATGTGTCTCA No data
Right 912456164 1:109798954-109798976 ATGCAATACACTTCTCCTAGGGG No data
912456158_912456164 7 Left 912456158 1:109798924-109798946 CCAAACATCTATGTGTCTCACTC No data
Right 912456164 1:109798954-109798976 ATGCAATACACTTCTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912456164 Original CRISPR ATGCAATACACTTCTCCTAG GGG Intergenic