ID: 912458467

View in Genome Browser
Species Human (GRCh38)
Location 1:109815619-109815641
Sequence CTGGTGTACCACCTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912458459_912458467 14 Left 912458459 1:109815582-109815604 CCTCAGGGGCAGGGCCGTGTACC No data
Right 912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG No data
912458460_912458467 0 Left 912458460 1:109815596-109815618 CCGTGTACCCAGTCATCCTGAGC No data
Right 912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG No data
912458462_912458467 -7 Left 912458462 1:109815603-109815625 CCCAGTCATCCTGAGCCTGGTGT No data
Right 912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG No data
912458454_912458467 29 Left 912458454 1:109815567-109815589 CCAGGGTGGGTAGGGCCTCAGGG No data
Right 912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG No data
912458463_912458467 -8 Left 912458463 1:109815604-109815626 CCAGTCATCCTGAGCCTGGTGTA No data
Right 912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912458467 Original CRISPR CTGGTGTACCACCTGGTGCC AGG Intergenic
No off target data available for this crispr