ID: 912462425

View in Genome Browser
Species Human (GRCh38)
Location 1:109844857-109844879
Sequence CATGGCAATCACACCGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912462417_912462425 25 Left 912462417 1:109844809-109844831 CCTCTTTGCTCCTCTTACCCCAA No data
Right 912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG No data
912462421_912462425 6 Left 912462421 1:109844828-109844850 CCAAGTCCATAAAAGCAACCATT No data
Right 912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG No data
912462418_912462425 15 Left 912462418 1:109844819-109844841 CCTCTTACCCCAAGTCCATAAAA No data
Right 912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG No data
912462422_912462425 0 Left 912462422 1:109844834-109844856 CCATAAAAGCAACCATTACACAG No data
Right 912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG No data
912462419_912462425 8 Left 912462419 1:109844826-109844848 CCCCAAGTCCATAAAAGCAACCA No data
Right 912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG No data
912462420_912462425 7 Left 912462420 1:109844827-109844849 CCCAAGTCCATAAAAGCAACCAT No data
Right 912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912462425 Original CRISPR CATGGCAATCACACCGTTGC TGG Intergenic
No off target data available for this crispr