ID: 912463323

View in Genome Browser
Species Human (GRCh38)
Location 1:109852054-109852076
Sequence GATGCTGGTGACCCACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912463323_912463329 12 Left 912463323 1:109852054-109852076 CCCATCTGTGGGTCACCAGCATC No data
Right 912463329 1:109852089-109852111 TAGATAAAACCACAAAGATGGGG 0: 5113
1: 2106
2: 955
3: 851
4: 795
912463323_912463327 10 Left 912463323 1:109852054-109852076 CCCATCTGTGGGTCACCAGCATC No data
Right 912463327 1:109852087-109852109 GGTAGATAAAACCACAAAGATGG 0: 2345
1: 4257
2: 1105
3: 370
4: 436
912463323_912463328 11 Left 912463323 1:109852054-109852076 CCCATCTGTGGGTCACCAGCATC No data
Right 912463328 1:109852088-109852110 GTAGATAAAACCACAAAGATGGG 0: 5233
1: 2002
2: 590
3: 329
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912463323 Original CRISPR GATGCTGGTGACCCACAGAT GGG (reversed) Intergenic
No off target data available for this crispr