ID: 912464127

View in Genome Browser
Species Human (GRCh38)
Location 1:109857975-109857997
Sequence GCTACTAATTAGGCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912464127_912464131 14 Left 912464127 1:109857975-109857997 CCTGCTTTTGCCTAATTAGTAGC No data
Right 912464131 1:109858012-109858034 TCTTTACTACCTGATTGGTCGGG 0: 129
1: 170
2: 96
3: 55
4: 221
912464127_912464130 13 Left 912464127 1:109857975-109857997 CCTGCTTTTGCCTAATTAGTAGC No data
Right 912464130 1:109858011-109858033 CTCTTTACTACCTGATTGGTCGG 0: 132
1: 116
2: 57
3: 30
4: 101
912464127_912464129 9 Left 912464127 1:109857975-109857997 CCTGCTTTTGCCTAATTAGTAGC No data
Right 912464129 1:109858007-109858029 AGCTCTCTTTACTACCTGATTGG 0: 118
1: 191
2: 124
3: 50
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912464127 Original CRISPR GCTACTAATTAGGCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr