ID: 912464704

View in Genome Browser
Species Human (GRCh38)
Location 1:109863773-109863795
Sequence CTATTGCCACAAATAGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912464704_912464705 12 Left 912464704 1:109863773-109863795 CCAAGTGCTATTTGTGGCAATAG No data
Right 912464705 1:109863808-109863830 AGAGATGAATACATAGCTCAAGG No data
912464704_912464706 13 Left 912464704 1:109863773-109863795 CCAAGTGCTATTTGTGGCAATAG No data
Right 912464706 1:109863809-109863831 GAGATGAATACATAGCTCAAGGG 0: 10
1: 24
2: 29
3: 39
4: 258
912464704_912464708 15 Left 912464704 1:109863773-109863795 CCAAGTGCTATTTGTGGCAATAG No data
Right 912464708 1:109863811-109863833 GATGAATACATAGCTCAAGGGGG 0: 7
1: 13
2: 39
3: 108
4: 175
912464704_912464707 14 Left 912464704 1:109863773-109863795 CCAAGTGCTATTTGTGGCAATAG No data
Right 912464707 1:109863810-109863832 AGATGAATACATAGCTCAAGGGG 0: 6
1: 21
2: 25
3: 41
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912464704 Original CRISPR CTATTGCCACAAATAGCACT TGG (reversed) Intergenic
No off target data available for this crispr