ID: 912468059

View in Genome Browser
Species Human (GRCh38)
Location 1:109887502-109887524
Sequence CAGAGTGGCCAGAGACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912468059_912468063 6 Left 912468059 1:109887502-109887524 CCCTCTTGTCTCTGGCCACTCTG No data
Right 912468063 1:109887531-109887553 GCTCATTCCTGTTGACGTTCAGG No data
912468059_912468065 22 Left 912468059 1:109887502-109887524 CCCTCTTGTCTCTGGCCACTCTG No data
Right 912468065 1:109887547-109887569 GTTCAGGATTCAGATAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912468059 Original CRISPR CAGAGTGGCCAGAGACAAGA GGG (reversed) Intergenic
No off target data available for this crispr