ID: 912468402

View in Genome Browser
Species Human (GRCh38)
Location 1:109889884-109889906
Sequence ATGTATGGCAGGCAGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912468398_912468402 4 Left 912468398 1:109889857-109889879 CCAGGGTGGTTTTTCCAGGACTA No data
Right 912468402 1:109889884-109889906 ATGTATGGCAGGCAGCACTGAGG No data
912468400_912468402 -10 Left 912468400 1:109889871-109889893 CCAGGACTAGAATATGTATGGCA No data
Right 912468402 1:109889884-109889906 ATGTATGGCAGGCAGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912468402 Original CRISPR ATGTATGGCAGGCAGCACTG AGG Intergenic
No off target data available for this crispr