ID: 912468402 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:109889884-109889906 |
| Sequence | ATGTATGGCAGGCAGCACTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912468398_912468402 | 4 | Left | 912468398 | 1:109889857-109889879 | CCAGGGTGGTTTTTCCAGGACTA | No data | ||
| Right | 912468402 | 1:109889884-109889906 | ATGTATGGCAGGCAGCACTGAGG | No data | ||||
| 912468400_912468402 | -10 | Left | 912468400 | 1:109889871-109889893 | CCAGGACTAGAATATGTATGGCA | No data | ||
| Right | 912468402 | 1:109889884-109889906 | ATGTATGGCAGGCAGCACTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912468402 | Original CRISPR | ATGTATGGCAGGCAGCACTG AGG | Intergenic | ||
| No off target data available for this crispr | |||||