ID: 912470731

View in Genome Browser
Species Human (GRCh38)
Location 1:109905008-109905030
Sequence CCCTTTAATGACATCTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912470725_912470731 16 Left 912470725 1:109904969-109904991 CCTGACTGAGGAGGCATTAGCAC No data
Right 912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG No data
912470724_912470731 17 Left 912470724 1:109904968-109904990 CCCTGACTGAGGAGGCATTAGCA No data
Right 912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG No data
912470720_912470731 28 Left 912470720 1:109904957-109904979 CCACCACAATTCCCTGACTGAGG No data
Right 912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG No data
912470719_912470731 29 Left 912470719 1:109904956-109904978 CCCACCACAATTCCCTGACTGAG No data
Right 912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG No data
912470722_912470731 25 Left 912470722 1:109904960-109904982 CCACAATTCCCTGACTGAGGAGG No data
Right 912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG No data
912470718_912470731 30 Left 912470718 1:109904955-109904977 CCCCACCACAATTCCCTGACTGA No data
Right 912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912470731 Original CRISPR CCCTTTAATGACATCTGAGG TGG Intergenic
No off target data available for this crispr