ID: 912471409

View in Genome Browser
Species Human (GRCh38)
Location 1:109909731-109909753
Sequence CAGTCTGAGCAAAGGCATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912471401_912471409 12 Left 912471401 1:109909696-109909718 CCATGTGGAGAAAGGAGCATTCC 0: 1
1: 0
2: 1
3: 16
4: 203
Right 912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG 0: 1
1: 0
2: 2
3: 34
4: 236
912471405_912471409 -9 Left 912471405 1:109909717-109909739 CCAGGCAGAGGGACCAGTCTGAG 0: 1
1: 1
2: 9
3: 127
4: 689
Right 912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG 0: 1
1: 0
2: 2
3: 34
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912471409 Original CRISPR CAGTCTGAGCAAAGGCATTC GGG Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902334749 1:15748442-15748464 CAGACTGAGCAAAACCATTCTGG + Intergenic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905737876 1:40343064-40343086 CAGTCTGATCAAGGCCATACAGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
906732908 1:48098579-48098601 CAGTATGAGCAAAGGCGTGCAGG - Intergenic
908071363 1:60463968-60463990 CAGTATATGCAAAGGCATTAAGG + Intergenic
908333625 1:63097401-63097423 CAGTATGAGCAAAGACATCGAGG + Intergenic
908887193 1:68802972-68802994 CAGTCAAAGCAAAGGCAAACTGG + Intergenic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
911069591 1:93822101-93822123 CAGTGTGGGCAAAGGCATTGAGG + Intronic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912978258 1:114348776-114348798 CAGCCTGAGCACAGGAATCCTGG + Intergenic
913494394 1:119415030-119415052 TATTCTGAGAAAAGGGATTCTGG + Exonic
914397030 1:147279462-147279484 CAAACTGAGAAAAGGCCTTCGGG + Intronic
914505113 1:148281962-148281984 AAGTGTGAGGAAAGGCAATCTGG + Intergenic
914507451 1:148302186-148302208 AAGTGTGAGGAAAGGCAATCTGG - Intergenic
915873566 1:159587963-159587985 CTGTGTGAGCAAAGGCTTCCAGG - Exonic
916455224 1:164964203-164964225 CAGTCCAAGCAAAAGCAGTCAGG + Intergenic
917792773 1:178509977-178509999 AAGTCTGAGCAAATGTATTGTGG - Intergenic
917794773 1:178525334-178525356 CAGGCAGAGGACAGGCATTCAGG - Intronic
918322263 1:183375445-183375467 CAGCCTGGGCAAAGGCATAGGGG - Intronic
919406924 1:197196813-197196835 CAGCATGTGCAAAGGCATTGAGG - Intronic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921982409 1:221272947-221272969 AATTCTGAGCAAAAGCACTCTGG - Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
923089494 1:230729014-230729036 GAGACTGAGCAAAGACAGTCAGG + Intergenic
923269176 1:232339261-232339283 CAGTCTGAGCATCAGCCTTCTGG + Intergenic
924239679 1:242029300-242029322 AATACTGAGTAAAGGCATTCAGG + Intergenic
924553402 1:245098812-245098834 CAGTCAGAACAATGGCAGTCAGG - Intronic
1063357405 10:5413266-5413288 CGGTCTGAGCAAAGGCATTTGGG - Intronic
1063625564 10:7686402-7686424 CAGTATGAGCAAAGGCTCCCAGG - Intergenic
1066455572 10:35568830-35568852 CAGTCTGAGAAAAGACTCTCAGG - Intronic
1066788726 10:39038306-39038328 GAATCTGAGAAAAGGCATTTGGG - Intergenic
1066807263 10:39271403-39271425 CTGTCTGAGAAAATGCATTGTGG - Intergenic
1069600169 10:69699675-69699697 CAGTCTGAGCTAACACATTTTGG - Intergenic
1069610968 10:69772299-69772321 CACTCTGAGCCAAGGAAGTCTGG + Intergenic
1069971215 10:72171342-72171364 GACTCTGAGCCAAGACATTCAGG - Intronic
1072628693 10:97131092-97131114 CAGGCCGAGCAAGGGCATTGTGG + Intronic
1073070471 10:100790311-100790333 CTGTCTCAGCAAAGGCTGTCTGG + Intronic
1073364373 10:102926277-102926299 AAGTCTGAGCATAGACATTTAGG + Intronic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1078663613 11:13306606-13306628 CATTCTGGGCAGAGGAATTCTGG + Intronic
1078976432 11:16483865-16483887 CGTTCTCAGCAAATGCATTCTGG + Intronic
1079306722 11:19329871-19329893 CAGCCTGTGCAAAGGCCTTGAGG + Intergenic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1081854910 11:46296937-46296959 CTGCCTGAGCCAAGGCCTTCAGG + Intronic
1083211475 11:61190007-61190029 CAGCCTGAGCAAACTCATCCAGG - Intergenic
1083380160 11:62260887-62260909 CAGCCTGGGCAAGGGCATGCAGG + Intergenic
1083702340 11:64487708-64487730 CAGTCTTGGCAAAGCCATGCTGG - Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085337122 11:75704825-75704847 CAGCATGAGCAAAGGCCCTCAGG + Intergenic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1087200425 11:95339208-95339230 CAGTCTGGCCTAAGTCATTCTGG + Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088430690 11:109755325-109755347 CAGACTGAGGAGAGGCATTTTGG + Intergenic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1089664076 11:120006306-120006328 CAGTGGGAGCAAGGGGATTCAGG + Intergenic
1090142969 11:124285063-124285085 AAGTCTGAGCCAAAGCAATCAGG + Intergenic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092772339 12:11908980-11909002 CAGTGTGTACAAAGGCATTCAGG + Intergenic
1094070065 12:26403163-26403185 CAGGATGAGCAAAGGCAAACAGG + Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1098150639 12:67543049-67543071 GATTCTGGGCAAATGCATTCTGG - Intergenic
1098328628 12:69329219-69329241 CAGCCTGAGAAAAGACATACAGG - Intergenic
1100000692 12:89831577-89831599 CAGTTTGAGCATGTGCATTCAGG - Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102242103 12:111331027-111331049 CAGCCTGAGCAAAGACATAGGGG + Intronic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1103732185 12:123035125-123035147 CAGTCTGAGCCATGCCATTAGGG + Intronic
1104475331 12:129066415-129066437 CAGTATGGGCAAAGGCCTTGAGG + Intergenic
1107734550 13:43384658-43384680 TGTTCTGAGCAAAGGCATTCAGG + Intronic
1108747735 13:53412078-53412100 CAGCTTGAGCAAAGGCATCTAGG + Intergenic
1109037863 13:57288537-57288559 CATTTTGAGTAAAGTCATTCAGG - Intergenic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1113435079 13:110285048-110285070 CAGTCTGGGCTGAGGCTTTCAGG + Intronic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1115763091 14:36595199-36595221 GAGTCTGAGCACAGGCATAGGGG + Intergenic
1117008602 14:51447508-51447530 CAGTCTGAGCAAAGGCCTAGAGG - Intergenic
1117055730 14:51910436-51910458 CATTTTGAGAAAAGGAATTCAGG + Intronic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1119980363 14:79073833-79073855 CAATTTGAGCACAGGCAGTCTGG - Intronic
1120513707 14:85445766-85445788 CAGCCAGTGCAAAGACATTCAGG - Intergenic
1121052596 14:90829266-90829288 GAGTCTGATAACAGGCATTCAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1124055069 15:26234743-26234765 CAGTCAGTGCAAAGGCCCTCAGG - Intergenic
1125003798 15:34796133-34796155 CTCTCTGAGTAAAGCCATTCAGG - Exonic
1126431079 15:48585503-48585525 CATTCTAAGAAAAGACATTCTGG - Intronic
1127381024 15:58430601-58430623 CAGTCTGTGCAAAGGCCCTGAGG - Intronic
1127402705 15:58606097-58606119 CACTCTCAGCAAATGCATTCTGG + Intronic
1128552734 15:68608755-68608777 AAGCCTGAGAAAGGGCATTCGGG - Intronic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1130679576 15:85984604-85984626 AAGTGTGTGCAAAGGCCTTCAGG - Intergenic
1130739867 15:86587560-86587582 CAGTATAAGCAAAGGCATAAAGG + Intronic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1130854572 15:87830150-87830172 CACTCTTAGCAAATGCATGCAGG - Intergenic
1137705102 16:50529761-50529783 AAGTGTGGGCAAAGGAATTCTGG + Intergenic
1144959279 17:19035806-19035828 CAGTCCGGGCAGAGGCCTTCCGG - Intronic
1144975880 17:19138718-19138740 CAGTCCGGGCAGAGGCCTTCCGG + Intronic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147650768 17:42060602-42060624 CAGCCGGAGCAAAGGCATTGAGG - Intronic
1155082336 18:22423170-22423192 CCTTCTGAGCAAAGGCAGTCTGG - Intergenic
1155304060 18:24462134-24462156 AAGAATGAGCAAAGGCATGCTGG + Intronic
1155839392 18:30628138-30628160 CACTCTCAACAAAGCCATTCAGG + Intergenic
1156937738 18:42731305-42731327 GAGGCTGAGCTAAAGCATTCAGG + Intergenic
1158651282 18:59288783-59288805 CAGTCTAACCAAAAGAATTCTGG - Intronic
1160279399 18:77473497-77473519 AAGTTTGAGCAAAGCCATCCAGG - Intergenic
1160916822 19:1500737-1500759 CAGCCTGTGCAAAGGCCTTGAGG + Intergenic
1161634202 19:5377102-5377124 CAGTCTGTGCAAAGGCCCTGAGG + Intergenic
1162544665 19:11321567-11321589 CATTCTGGGCAAAGGCCTTGGGG + Intronic
1163015091 19:14450035-14450057 CAGTCTGAGCAATGACACACAGG - Intronic
1165905117 19:39189021-39189043 CAGTCAGTGCAAAGGCCTTGAGG - Intergenic
1166328320 19:42064873-42064895 GAGGGTCAGCAAAGGCATTCTGG - Intronic
1166537880 19:43586628-43586650 CACTCCGAGCAAAGGCATGGGGG + Exonic
1167935893 19:52907930-52907952 CAATATGATCAAAGGCATGCTGG - Intergenic
925430482 2:3787720-3787742 GACTCTGAGCAGAGGAATTCAGG - Intronic
925946334 2:8867346-8867368 GAGGCTGGGCAAAGGAATTCAGG - Intronic
927125132 2:20006766-20006788 TAGTCTGAGGCAAGGCACTCAGG + Intronic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930625956 2:53697879-53697901 AAGTCTGAGCAAAGCCATAGGGG - Intronic
931384588 2:61786626-61786648 CCATCTGAGCAAAGGCATGGAGG + Intergenic
931443042 2:62304774-62304796 GATTCTGAGCAAAGTCATTATGG - Intergenic
931915837 2:66955448-66955470 AATTCTGAGCAAAGACATTGGGG - Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
935688337 2:105706893-105706915 CAGCCTGGGCAAAGGCACTGGGG - Intergenic
935827761 2:106968618-106968640 AAGTCTGAGGAAAGGCATTTAGG - Intergenic
936702579 2:115031189-115031211 CAGTCTTAGAAGAGTCATTCAGG + Intronic
938080472 2:128367391-128367413 AAGGCTGAGCAAAGGCAGTGGGG + Intergenic
938941087 2:136170277-136170299 CAGTCAGTGGAAAGGGATTCAGG + Intergenic
939414890 2:141882963-141882985 CAGTCTCACCAAAGGCATTGCGG + Intronic
943287180 2:186016795-186016817 CAGTCAGAACTAAGGGATTCAGG + Intergenic
944204586 2:197144169-197144191 CTGTCTGCTCAGAGGCATTCAGG + Intronic
944801395 2:203240630-203240652 CATTCTGAGAAAGAGCATTCTGG + Intronic
944914629 2:204345637-204345659 CAGTCTTAGCAAGGTCATTAAGG + Intergenic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
945750245 2:213773288-213773310 GAATCTGAGCAAAGTCATTTAGG + Intronic
946104336 2:217355993-217356015 CAGCCTGAGCTAAGGCACTGTGG + Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946596358 2:221309899-221309921 CAGTCTGAGCATAAGCGTCCCGG - Intergenic
948747383 2:240106521-240106543 GAGCCTGAGCAATGTCATTCTGG - Intergenic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1172110811 20:32543953-32543975 CAGCCTGTGCAAAGGTCTTCAGG + Intronic
1172754320 20:37272736-37272758 CAGCCTGAGCAAAGGCTTGGAGG + Intergenic
1172776036 20:37407596-37407618 CAGCCTGGGCAAAGGCATGGAGG - Intergenic
1173027060 20:39317814-39317836 GAGTTTGAGTAAAGGCATACAGG - Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173946485 20:46954997-46955019 CAGGCTGAGAAAAGGCCTGCAGG - Intronic
1174515945 20:51092624-51092646 GAGGGTGAGAAAAGGCATTCAGG - Intergenic
1175829625 20:61955027-61955049 CAGCCTGGGAAAAGGCATACAGG - Intronic
1176384882 21:6134303-6134325 CAGGCTGTGCCATGGCATTCTGG + Intergenic
1177390967 21:20471479-20471501 GAGGGTGAGCAAAAGCATTCAGG + Intergenic
1177763517 21:25430296-25430318 CAGGATGAGACAAGGCATTCTGG - Intergenic
1178522475 21:33298008-33298030 CAGCTTGAGCAAAAGCAGTCTGG + Intergenic
1179309880 21:40185926-40185948 AAGTCTGAGGAAGGGCCTTCCGG - Intronic
1179738590 21:43403949-43403971 CAGGCTGTGCCATGGCATTCTGG - Intergenic
1182741475 22:32571141-32571163 CAGTCTGAGGAAGGCCTTTCAGG + Intronic
1183579736 22:38716793-38716815 CAGTGTGGGCAACGACATTCTGG + Exonic
1183989892 22:41590632-41590654 AAGCCTGAACAAAGGCCTTCAGG - Intergenic
949367981 3:3303622-3303644 AAGTCTGAGAAAATACATTCTGG + Intergenic
949910679 3:8904383-8904405 CAGGCACAGCAAAGACATTCAGG + Intronic
950280854 3:11706775-11706797 CAGTCTGAGAAAAGGCACAGGGG + Intronic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
951707564 3:25558660-25558682 CTGTCAGAGCAATGGCATTGTGG - Intronic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954385703 3:50242764-50242786 CAGTCTGAGCAAAGGCCTAAAGG + Intronic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
958049047 3:88321009-88321031 CAGACTGAGAAAATACATTCAGG + Intergenic
960009983 3:112823210-112823232 AAGTCTGAGAACAGCCATTCGGG - Intronic
962665367 3:137648927-137648949 CAGTTTGAGCAAAGGTACACAGG - Intergenic
963909452 3:150803043-150803065 AATTCTGAGCTAAGGAATTCAGG - Intergenic
964280961 3:155064622-155064644 CAGTATGTTCAAAGGCATGCAGG - Intronic
964512038 3:157463483-157463505 CAATCTAGACAAAGGCATTCAGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
967807416 3:193728145-193728167 CAGTGTGGGCAAAGGTATGCGGG + Intergenic
968016388 3:195337978-195338000 CAGCCAGTGCAAAGGCATTGAGG - Intronic
969145482 4:5119903-5119925 CAATCTACGCATAGGCATTCGGG + Intronic
969237608 4:5877032-5877054 CAGTCTGAGCACAAGCTTTAAGG + Intronic
971846846 4:31929314-31929336 CAGTCTCACCAAAGGCTTGCAGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
975877972 4:78867016-78867038 CAGCCTGAGCAATGGCATGGTGG + Intronic
976095541 4:81504906-81504928 CTGACTGAGCAAAGGCTTTCTGG + Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
981934733 4:150227546-150227568 CAGTCTGAGCAAAGGCCCAGAGG + Intronic
982483291 4:155936947-155936969 CAGTCTGTACAAAGCAATTCTGG + Intronic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
984316029 4:178133610-178133632 CAGCCAGAGCAAAGGCTGTCAGG + Intergenic
984823288 4:183903320-183903342 CAGTCTGTGCAAAGGCCCTGGGG - Intronic
985790662 5:1925399-1925421 CAGTCCCAGCAAGGCCATTCTGG - Intergenic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
988849458 5:35164446-35164468 GATTCTCAGAAAAGGCATTCCGG + Intronic
992688899 5:79224207-79224229 CAGTCTCCCCAAAGGCTTTCAGG + Intronic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
995733601 5:115273264-115273286 CAAGATAAGCAAAGGCATTCAGG + Intronic
997374245 5:133385462-133385484 CAGTCTTGGAAAAGGAATTCAGG - Intronic
998815796 5:146013079-146013101 CAGTCTTAGCATAAGGATTCAGG + Intronic
998819850 5:146048696-146048718 CTACCTGATCAAAGGCATTCAGG - Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1001138589 5:169123775-169123797 CAGTCAGAGCAAAGGCAGACTGG + Intronic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001815726 5:174667852-174667874 CAGCATGAGGAAAGGCATTCAGG + Intergenic
1002110525 5:176907113-176907135 CAGTCTGAGCACAAGACTTCAGG - Exonic
1004167282 6:13267944-13267966 CACTCTGTCTAAAGGCATTCAGG + Intronic
1004188977 6:13447780-13447802 CAGTCAAAGCAAAGTCATTAGGG + Intronic
1004675557 6:17838537-17838559 CATTCTGATCAAATGAATTCTGG - Intronic
1006502721 6:34468600-34468622 CAGCCTGTGCAAAGGCCTGCAGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1012786171 6:103629824-103629846 CATTATTAGCAAAGGCACTCTGG + Intergenic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1016471884 6:144383303-144383325 AAGTCTGAGGAAAGAAATTCAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018412321 6:163563534-163563556 TTGTCTGATCAAAGGCATTATGG - Exonic
1020107679 7:5429674-5429696 CCGTCTGAGCACAGGCTTTGGGG + Intergenic
1022539904 7:31125802-31125824 CAGGCTGAGCCAAGGCACACTGG - Intergenic
1022908610 7:34879079-34879101 GAGTCTGAGCTAAGCCACTCTGG - Intergenic
1025599203 7:62973755-62973777 CATTCTGAGAAAAGACATTTGGG + Intergenic
1026054489 7:66972606-66972628 CTGTCTTAGCAAAGGCTTTCTGG + Intergenic
1026234796 7:68517720-68517742 CAGATTGAGCAAAGGTACTCTGG - Intergenic
1030547801 7:110919705-110919727 CATTGTGAGCTAAGGCATTAGGG + Intronic
1032233572 7:130099602-130099624 CAGCTTGAGTAAAGGCATTTAGG + Intronic
1034016545 7:147593705-147593727 CTGTTTGAGATAAGGCATTCTGG + Intronic
1036537819 8:9668732-9668754 CAACATGAGCAAAGACATTCAGG + Intronic
1038380778 8:27091272-27091294 CAGTGTGAGCAAGGGCACTCAGG - Intergenic
1038646579 8:29366691-29366713 CAGTGTGAACCAAAGCATTCAGG - Intergenic
1039236259 8:35505822-35505844 GAGTCTGATCAAAGGCAGTCCGG - Intronic
1041342972 8:56865582-56865604 CAGTGTCTGGAAAGGCATTCAGG - Intergenic
1042834174 8:73063098-73063120 CAGGCTGAACAAAGACATCCAGG + Intergenic
1045727885 8:105196697-105196719 CAGTCTCAGCACATGCATTCTGG + Intronic
1045919984 8:107518303-107518325 CAGTCTGAGGAATGGCAGTCGGG + Intergenic
1047551239 8:125874591-125874613 CTGTGTGAGCAAAGGCACACAGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048181964 8:132203406-132203428 CAGTCTCAGCAAACGACTTCTGG + Intronic
1048736695 8:137510094-137510116 CAGGCTGTGCAAATGCCTTCTGG + Intergenic
1048778448 8:137974163-137974185 AAGTATGGGCAAAGGCATTCAGG - Intergenic
1050756985 9:9016711-9016733 CAGTCTTTGCAAAGTCATTTGGG + Intronic
1050913510 9:11103233-11103255 CAGTCTTAGATAAGGCATTTTGG - Intergenic
1053178342 9:35945702-35945724 GTGTCTGAGAAAGGGCATTCTGG + Intergenic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1056227108 9:84506417-84506439 CCATCTGAGCAAAGGGCTTCTGG - Intergenic
1056474394 9:86939437-86939459 CAGCGTGACCAAAGGCATACAGG - Intergenic
1056980440 9:91305806-91305828 CAGTCTGAGCACAGGCTGTCTGG + Intronic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1188153840 X:26716133-26716155 CAGTCAGAGCAAAAGCAGACTGG - Intergenic
1190286356 X:48963950-48963972 CAGCCTGTGCAAAGGCCTTGAGG - Intronic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1191264240 X:58367599-58367621 CATTCTGAGAAAAGACATTTAGG - Intergenic
1192030246 X:67503506-67503528 CAATTTGAGCAAAGGAGTTCTGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1194851172 X:98871066-98871088 CATTCTGAACATAGGCATTCTGG - Intergenic
1194990405 X:100541252-100541274 CAACCTGAGCAATGCCATTCAGG - Intergenic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1196228486 X:113193562-113193584 AAGTCTGAGAAAAGTCATTTAGG - Intergenic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1199845965 X:151693550-151693572 CAGTGGGAGGAAAGGCATTCTGG + Intergenic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic