ID: 912471774

View in Genome Browser
Species Human (GRCh38)
Location 1:109911385-109911407
Sequence ACCCGCCACCACCAAGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912471768_912471774 -8 Left 912471768 1:109911370-109911392 CCTGCCTCTCTCCCTACCCGCCA 0: 1
1: 0
2: 5
3: 87
4: 841
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471758_912471774 29 Left 912471758 1:109911333-109911355 CCACCTGCAGGCAGGAGCCCCCG 0: 1
1: 0
2: 2
3: 61
4: 416
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471759_912471774 26 Left 912471759 1:109911336-109911358 CCTGCAGGCAGGAGCCCCCGCTC No data
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471767_912471774 -7 Left 912471767 1:109911369-109911391 CCCTGCCTCTCTCCCTACCCGCC 0: 1
1: 0
2: 6
3: 142
4: 2219
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471765_912471774 9 Left 912471765 1:109911353-109911375 CCGCTCAGCCAGGGTGCCCTGCC 0: 1
1: 0
2: 4
3: 30
4: 404
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471762_912471774 12 Left 912471762 1:109911350-109911372 CCCCCGCTCAGCCAGGGTGCCCT 0: 1
1: 0
2: 0
3: 18
4: 228
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471766_912471774 1 Left 912471766 1:109911361-109911383 CCAGGGTGCCCTGCCTCTCTCCC 0: 1
1: 0
2: 3
3: 76
4: 808
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471763_912471774 11 Left 912471763 1:109911351-109911373 CCCCGCTCAGCCAGGGTGCCCTG 0: 1
1: 0
2: 0
3: 37
4: 283
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data
912471764_912471774 10 Left 912471764 1:109911352-109911374 CCCGCTCAGCCAGGGTGCCCTGC 0: 1
1: 0
2: 3
3: 55
4: 363
Right 912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912471774 Original CRISPR ACCCGCCACCACCAAGGCAC GGG Intronic
No off target data available for this crispr