ID: 912474313

View in Genome Browser
Species Human (GRCh38)
Location 1:109925832-109925854
Sequence CTGTGGCTAGGCAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 1, 2: 4, 3: 67, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912474313_912474321 3 Left 912474313 1:109925832-109925854 CCCAGCTCCCTGCCTAGCCACAG 0: 1
1: 1
2: 4
3: 67
4: 516
Right 912474321 1:109925858-109925880 ATGCCATCTTCCAGTCAGACTGG No data
912474313_912474325 27 Left 912474313 1:109925832-109925854 CCCAGCTCCCTGCCTAGCCACAG 0: 1
1: 1
2: 4
3: 67
4: 516
Right 912474325 1:109925882-109925904 AGAAACGTCTTCCTCATGCGAGG No data
912474313_912474322 4 Left 912474313 1:109925832-109925854 CCCAGCTCCCTGCCTAGCCACAG 0: 1
1: 1
2: 4
3: 67
4: 516
Right 912474322 1:109925859-109925881 TGCCATCTTCCAGTCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912474313 Original CRISPR CTGTGGCTAGGCAGGGAGCT GGG (reversed) Intronic
900395157 1:2450509-2450531 GTGGGGCCAGGCAGGGAGTTGGG - Intronic
900536853 1:3182919-3182941 GAGTGGGGAGGCAGGGAGCTCGG - Intronic
900955557 1:5884466-5884488 CGGGGGCTCGGCTGGGAGCTTGG - Intronic
900955569 1:5884515-5884537 CGGGGGCTCGGCTGGGAGCTTGG - Intronic
900955581 1:5884564-5884586 CGGGGGCTCGGCTGGGAGCTTGG - Intronic
900955593 1:5884613-5884635 CGGGGGCTCGGCTGGGAGCTTGG - Intronic
900955605 1:5884662-5884684 CGGGGGCTCGGCTGGGAGCTTGG - Intronic
900955649 1:5884850-5884872 CAGGGGCTCGGCTGGGAGCTTGG - Intronic
900955689 1:5885040-5885062 CGGGGGCTCGGCTGGGAGCTTGG - Intronic
900955701 1:5885089-5885111 CAGGGGCTCGGCTGGGAGCTTGG - Intronic
901197535 1:7448457-7448479 CTGTGTCCAAGCTGGGAGCTGGG + Intronic
901508738 1:9703350-9703372 CTCAGGCTATCCAGGGAGCTAGG + Intronic
901740742 1:11340092-11340114 CCGTGGCAAGGCAGGGCCCTGGG + Intergenic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
902561430 1:17280004-17280026 CTTTGGCTTAGCGGGGAGCTGGG - Intronic
902634426 1:17725921-17725943 CTGGAGCTTGCCAGGGAGCTGGG + Intergenic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903170386 1:21548751-21548773 CAGTGGGGAGGCAGGGAGCAGGG - Intronic
903320903 1:22542676-22542698 CTGCGTCTAGACAGGGAGTTGGG - Intergenic
903502975 1:23812078-23812100 CTGTGGCTAGGCCCCAAGCTGGG + Intronic
903538429 1:24082536-24082558 CCTGGGCTGGGCAGGGAGCTGGG - Intronic
903786375 1:25863844-25863866 GTGGGCCTGGGCAGGGAGCTGGG + Exonic
904185871 1:28704307-28704329 CTGTGACTTGGAAGGGAGCCTGG - Exonic
905349838 1:37337867-37337889 CTGCTCCAAGGCAGGGAGCTGGG - Intergenic
905475517 1:38224445-38224467 CTGTGTCTAGGCAGTGGGCAAGG - Intergenic
905844098 1:41212010-41212032 CTGTTGCGGGGTAGGGAGCTGGG + Intronic
905987774 1:42302552-42302574 GTATGCCTAGGCATGGAGCTGGG + Intronic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
912040409 1:105383260-105383282 GTGTGCCTAGGCATGGAGCCTGG + Intergenic
912207278 1:107522617-107522639 CTGGTGCTGGGCTGGGAGCTTGG - Intergenic
912474313 1:109925832-109925854 CTGTGGCTAGGCAGGGAGCTGGG - Intronic
913212558 1:116593697-116593719 CTGTGGCTAGGCTGAGAGGGAGG - Intronic
913404221 1:118471151-118471173 CTGTGGCTATACAGTGAGCTGGG + Intergenic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
915546116 1:156598916-156598938 CAGATGGTAGGCAGGGAGCTGGG + Intronic
915598204 1:156907198-156907220 CTGTTGCAAGGCAGGGTGCAGGG + Intronic
916060594 1:161095973-161095995 CTAAGGCTAGGTAGGAAGCTGGG + Intergenic
918019893 1:180677216-180677238 CTCTGTCTAGGCAGTGAGCAAGG - Intronic
918307306 1:183259029-183259051 CTCTGTCTAGGCAGCGAGCAAGG + Intronic
918623691 1:186633991-186634013 CTGTGTCTAGGCAGTGGGCAAGG + Intergenic
918740864 1:188128745-188128767 GTGTGCCTAGGCATGGAACTGGG - Intergenic
918988255 1:191661350-191661372 CTCTGTCTAGGCAGTGAGCAAGG + Intergenic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
921317143 1:213903203-213903225 CTGGGGCTGGGCAGGGGCCTGGG + Intergenic
922219290 1:223545496-223545518 CTGAGGCCAGGCACAGAGCTAGG + Intronic
922562020 1:226576251-226576273 CTGTTGCTGGGCAAGGGGCTAGG + Intronic
922594929 1:226806329-226806351 CTGTGGCTAAGCAGGTGGTTGGG - Intergenic
922910319 1:229210353-229210375 CTGTGGCTATGTAGTGACCTCGG - Intergenic
923073629 1:230589563-230589585 ATGCGGTTAGGAAGGGAGCTAGG - Intergenic
924220695 1:241872501-241872523 CTGTGGCAGGGTAGGGGGCTAGG - Intronic
1063311310 10:4955254-4955276 GTGTGCCTAGGCATGGAGTTGGG + Intronic
1063316485 10:5011215-5011237 GTGTGCCTAGGCATGGAGTTGGG - Intronic
1063445073 10:6108190-6108212 ATATGGCAACGCAGGGAGCTGGG + Intronic
1063515232 10:6688700-6688722 CTCAGGGTAGGCAAGGAGCTTGG - Intergenic
1063542784 10:6950951-6950973 CTATGGGCAGGGAGGGAGCTGGG + Intergenic
1063606366 10:7526318-7526340 TTGAGGCGACGCAGGGAGCTGGG - Intergenic
1064553010 10:16521277-16521299 CTGCGGCTGGGGAGGGAGCGCGG + Exonic
1065197576 10:23281510-23281532 CTGTGGCGGGGCTGGGGGCTGGG + Intronic
1065716062 10:28569658-28569680 CTGTGGCTGGGCAAGGAGGTTGG + Intronic
1067082212 10:43218193-43218215 GTGTGTCTAGGGAGGCAGCTGGG - Intronic
1067552641 10:47246319-47246341 CTGTGTTTGGGAAGGGAGCTGGG + Intergenic
1069898327 10:71692641-71692663 CAGGGGCTGAGCAGGGAGCTGGG - Intronic
1069953310 10:72034439-72034461 CTGAGTGTGGGCAGGGAGCTGGG - Intergenic
1070551533 10:77494361-77494383 CTGAGGCTAGCCAGGCAGCTGGG - Intronic
1071445613 10:85743532-85743554 CTGTGTCTAGGAAGGAAGATAGG + Intronic
1071497482 10:86179010-86179032 CTCAGGCTAGGCTGGGACCTGGG - Intronic
1073724684 10:106216252-106216274 CTGTGGCCTGGCAGGGAGCTGGG - Intergenic
1074500564 10:114019942-114019964 CTGTGTTAAGGCAGGGTGCTAGG - Intergenic
1074581433 10:114723060-114723082 CTGTGGCTGCGCACTGAGCTAGG - Intergenic
1075151297 10:119935068-119935090 CTGCCTCTAGGCAGGGAGGTTGG - Intronic
1075180167 10:120204230-120204252 GTGTGTCTAGGCCTGGAGCTAGG + Intergenic
1076624140 10:131811226-131811248 CTCTGACTGGGCTGGGAGCTGGG - Intergenic
1076669484 10:132111670-132111692 CCATGGCGAGGCAAGGAGCTTGG + Intronic
1076717894 10:132375768-132375790 CCGTAGCTGGGCAGGGAGCAGGG - Exonic
1076908846 10:133377588-133377610 CTATGTCTGGGCAGTGAGCTGGG + Intergenic
1077217478 11:1400968-1400990 TTGAGGCCAGGCTGGGAGCTGGG - Intronic
1077344385 11:2039612-2039634 CTGGGGCTGGGAAGGGAGCTGGG - Intergenic
1077659543 11:4055289-4055311 CTGGAGCCAGGAAGGGAGCTGGG - Intronic
1078067421 11:8087513-8087535 CTGTGCCCAGGCACAGAGCTTGG + Intronic
1078266700 11:9760272-9760294 CTGTGGGCGGGCAGGGAGCCAGG + Intergenic
1078549501 11:12270438-12270460 CTGCTGCAAGGCAGGGAGCTGGG - Intergenic
1078739812 11:14055915-14055937 CTGGGGTTAGGCAGGCAGCCTGG - Intronic
1078773798 11:14375426-14375448 TTGTGTCTAGGCTTGGAGCTTGG - Intergenic
1079027498 11:16960688-16960710 CTGTGGCTGAGCAGGGACCCAGG - Intronic
1079134786 11:17770323-17770345 CCATGGCTAGGCAGGGAGAAGGG + Intronic
1079240377 11:18718257-18718279 CTGTGGGGAGGCAGGAATCTTGG - Intronic
1079319288 11:19438328-19438350 GTGTGGCAAGACAGGGAGCAGGG + Intronic
1079453603 11:20618531-20618553 CTGTGGCTTGGAACTGAGCTTGG - Intronic
1079943331 11:26710013-26710035 CTGTGGGTGGGTAGGGGGCTAGG - Intronic
1079971765 11:27043590-27043612 CTGTGGCGGGGTAGGGGGCTAGG - Intronic
1081410884 11:42756932-42756954 CTGATGCTAGGCAGGTGGCTGGG + Intergenic
1083262925 11:61532870-61532892 GAGTGGCCAGGCAGGGAACTGGG - Intronic
1083352508 11:62040931-62040953 TTGAGGCTAGGTGGGGAGCTTGG + Intergenic
1083594172 11:63911145-63911167 CTGTGGGTAAGTGGGGAGCTGGG - Intergenic
1084094793 11:66903974-66903996 CTGTAGCTGGGCATGGTGCTGGG - Intronic
1084172063 11:67405572-67405594 CTGTGGGTAGCCAGGAAGGTGGG - Intronic
1084270500 11:68026912-68026934 CTGGGGCTGGGGAGGCAGCTAGG - Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084426284 11:69086093-69086115 ATGTGGCTATGCAGGGGGCAGGG - Intronic
1084492283 11:69485459-69485481 CTGCGCCTAGGCAGGCACCTGGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086494153 11:87385167-87385189 GAGTGCCTAGGCATGGAGCTGGG - Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1088425517 11:109697141-109697163 ATGTGCCTAAGCATGGAGCTGGG - Intergenic
1088471022 11:110187605-110187627 GTGTGCCTAGGTATGGAGCTGGG - Intronic
1088608740 11:111556765-111556787 CTCTGGATAGTCAGGAAGCTTGG + Intronic
1088805667 11:113349905-113349927 CTCTGGGTGGGCAAGGAGCTAGG + Intronic
1089458810 11:118641027-118641049 CTGTGGCCTGGCATGGAGTTTGG + Intronic
1090372678 11:126267841-126267863 CTGGGCCCAGGCAGGGAGCTTGG - Intronic
1090412014 11:126515742-126515764 GTGTGGCCTGGCAGGGAGCTTGG + Intronic
1090441450 11:126728496-126728518 CAGGGGCCAGGCAGGGTGCTTGG - Intronic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1202827371 11_KI270721v1_random:94801-94823 CTGGGGCTGGGAAGGGAGCTGGG - Intergenic
1091703238 12:2677666-2677688 CTGTGGCTGGCTGGGGAGCTTGG + Intronic
1091779752 12:3206195-3206217 CTGTGGCTTATCAGGGTGCTGGG + Intronic
1092023230 12:5219942-5219964 CCGTGGCTAGGTAGGTAACTTGG - Intergenic
1095259509 12:40082517-40082539 GTGTGGCCAGGCAGGGACCCTGG + Intronic
1095580169 12:43788430-43788452 CTGTGGCTTTGCAGGGTGCGTGG - Intronic
1095626168 12:44317982-44318004 GTATGTCTAGGCATGGAGCTTGG + Intronic
1095908059 12:47397575-47397597 GTGTGCCTAGGCATGGAGCTAGG - Intergenic
1096678879 12:53241890-53241912 TTGTGGCCAGGCTGGGGGCTGGG - Intergenic
1097662476 12:62445969-62445991 GTGTGCCTAGGTATGGAGCTGGG + Intergenic
1098371723 12:69767541-69767563 GTGTGCCTAGGCATGGAGCTGGG + Intronic
1099768485 12:87021310-87021332 ATGTGCCTAGGCATGGAACTGGG - Intergenic
1101406457 12:104433274-104433296 CTGGAGCTTGGCAGGCAGCTTGG + Intergenic
1101965897 12:109281648-109281670 CAGTGGCTGGGGTGGGAGCTGGG + Exonic
1102349172 12:112179535-112179557 CTGTGCCCAGGGAGGGAGCCAGG - Intronic
1102766357 12:115436947-115436969 CTGTCTCTAGGCACAGAGCTAGG - Intergenic
1103211431 12:119169840-119169862 CTGTGTCTAGGCAGGACCCTCGG - Intergenic
1103222321 12:119256138-119256160 CTATGGCTAGGCACTGTGCTGGG + Intergenic
1103320998 12:120092924-120092946 CTGGGGCTGGACAGGGAGGTGGG - Intronic
1103554350 12:121757104-121757126 GTGTGGCAAGGGAGGGAGCTCGG + Intronic
1103872127 12:124099593-124099615 CAGTATCCAGGCAGGGAGCTTGG + Intronic
1104113174 12:125723283-125723305 CTGTAGCTAGGCAAGGATGTAGG - Intergenic
1104160184 12:126171491-126171513 CTGAGGCTATGCAGGGTGTTGGG + Intergenic
1104211300 12:126691336-126691358 CAGTGGTTAGGCAGGCAGCGTGG - Intergenic
1104349448 12:128032060-128032082 CTCTGTCTAGGCAGAGAGCAAGG + Intergenic
1104360376 12:128127547-128127569 CCCTGGCTAGGAAGGAAGCTTGG - Intergenic
1104426633 12:128683241-128683263 CTGTGGCCAGGCAGAAACCTCGG - Intronic
1105215803 13:18284320-18284342 CTGTGGCTAGGCCGAGAGGGAGG - Intergenic
1106133880 13:26960192-26960214 CTGGGGCTAGGTGGTGAGCTGGG - Intergenic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1107358763 13:39596814-39596836 CTGTCACTTGGCAGAGAGCTTGG + Intronic
1108440917 13:50451781-50451803 ATGTGGGAAGGCAGGGAGCAGGG + Intronic
1108864993 13:54912186-54912208 GTATGCCTAGGCATGGAGCTTGG - Intergenic
1109594416 13:64531023-64531045 CTCTGTCTAGGCAGGGAGCAAGG + Intergenic
1110128607 13:71979020-71979042 GGGTGCCTAGGCATGGAGCTGGG - Intergenic
1110742912 13:79018679-79018701 GTGTGCCTAGGCATGGAGCTAGG - Intergenic
1112078257 13:95936592-95936614 GTGTGCCTAGGCATGGAGCTGGG + Intronic
1112387959 13:98957919-98957941 CTGTGCCTGTGCAGGCAGCTGGG - Intronic
1112558426 13:100490722-100490744 CTGTGGCTGGCCAGGGAGCAGGG - Intronic
1112568453 13:100571108-100571130 CTTTGGATTGGCAGAGAGCTAGG - Intronic
1113892823 13:113745380-113745402 CTGTGGCTGGTCTGGGAGATGGG - Intergenic
1113892835 13:113745439-113745461 CTGTGGCTGGTCTGGGAGATGGG - Intergenic
1113892847 13:113745498-113745520 CTGTGGCTGGTCTGGGAGATGGG - Intergenic
1113892871 13:113745616-113745638 CTGTGGCTGGTCTGGGAGATGGG - Intergenic
1114184029 14:20386624-20386646 CTGGGGATAAGCAGAGAGCTGGG + Intronic
1114474259 14:22982578-22982600 CTGTGGCTAGCGTGAGAGCTAGG - Exonic
1114627183 14:24137209-24137231 CCGCGGCTGGGCAGGGAGCTAGG + Intronic
1114969331 14:28005813-28005835 GTGTGGCTAGGAAGGGAGCCTGG + Intergenic
1116222758 14:42110566-42110588 ATGTGCCTAGGCATGGAGCTTGG + Intergenic
1118882818 14:69843287-69843309 CTGTGGCTTGGCTAGGGGCTAGG - Intergenic
1120352576 14:83381713-83381735 CTTTGGTAAGGCAGGGTGCTTGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1121122483 14:91384802-91384824 CTGTGGCCAGGAAGGGAGTGGGG - Intronic
1121338868 14:93093300-93093322 CTGGGGCAGGGCAGAGAGCTGGG - Intronic
1121631215 14:95423075-95423097 CAGTGGCTGGGCAGGGGGCTGGG + Intronic
1122134382 14:99624503-99624525 GTGTGCCTAGGTTGGGAGCTGGG - Intergenic
1122366802 14:101199215-101199237 CCGTGGCTGGGCAGGGGGCAGGG + Intergenic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1123706031 15:22951666-22951688 CTGTGGCTTCCCAGGGTGCTCGG - Intronic
1123807988 15:23895065-23895087 CTGTGGTTTGGCAAGGATCTTGG - Intergenic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1125530984 15:40413209-40413231 ATGTGGCTAGGCTGTGAGCTGGG + Intronic
1125605973 15:40940231-40940253 CTGTGGACAGGCTGAGAGCTGGG - Intergenic
1128801609 15:70500622-70500644 CTGATGCCAGGCAGGGAGGTGGG + Intergenic
1129035539 15:72646473-72646495 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129110480 15:73334280-73334302 CTGTGGCTGGGCTGGGGCCTGGG + Intronic
1129164317 15:73767691-73767713 CTGTTGAGAGGCAGGGAGCCGGG - Intergenic
1129214345 15:74090743-74090765 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129253457 15:74320919-74320941 CAGTGGCTGGGAAGGGAGCTTGG + Intronic
1129391063 15:75221182-75221204 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129473244 15:75766687-75766709 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129731487 15:77935093-77935115 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129811933 15:78518145-78518167 CTCTGTCAAGGCAGTGAGCTGGG + Intronic
1129871704 15:78945405-78945427 TTGGGGATAGGCAGGGAGATGGG - Intronic
1129871884 15:78945973-78945995 GTGGGGATAGGCAGGGAGATGGG - Intronic
1130050330 15:80478975-80478997 TTGAGGCGAGGCAGGGAGCCAGG + Intronic
1130745249 15:86646492-86646514 CTCAGGTTAGGCAGGGAGCCAGG - Intronic
1131640082 15:94283208-94283230 GTGTGGCCAGGCAGGGACCCTGG + Intronic
1132669055 16:1095284-1095306 CTGTGGCTGGGCAGAGCCCTGGG + Intronic
1132688540 16:1172237-1172259 CTGGAGCTTGGCAGGGAGTTGGG + Intronic
1132809982 16:1792853-1792875 CAGAGGCTGGACAGGGAGCTGGG + Intronic
1133014708 16:2933984-2934006 CTGGGGGTGGGCTGGGAGCTGGG + Intronic
1133680134 16:8113510-8113532 CTGTGTCTAGGCAGCGGGCAAGG + Intergenic
1133964810 16:10523000-10523022 CTGTGGGTAGACAGGGAACTGGG + Intergenic
1134740646 16:16540634-16540656 CTCTGTCTAGGCAGGGGGCCAGG + Intergenic
1134743925 16:16572804-16572826 CTGTTGCTAGGCAGAGACCCCGG + Intergenic
1134926856 16:18171538-18171560 CTCTGTCTAGGCAGGGGGCCAGG - Intergenic
1135001557 16:18780947-18780969 CTGTTGCTAGGCAGAGACCCCGG - Intergenic
1135406579 16:22202517-22202539 CAGGGGCTGGGAAGGGAGCTTGG - Intergenic
1136549625 16:30976006-30976028 CGGTGGGGAGGCAGGGAGATGGG + Intronic
1137579374 16:49623870-49623892 CTGTGGCTAGGTAGGGACCAGGG + Intronic
1137584844 16:49658272-49658294 CTCTGGCCAGGCACGGTGCTGGG - Intronic
1137648207 16:50094279-50094301 GTGTGGCTAAGCAGTGGGCTTGG + Intronic
1137677272 16:50309873-50309895 GTGTGGGTAGGCAGGGAGTGAGG + Intronic
1138443252 16:57047481-57047503 CTGGGGCTAGCCAGGGACCCTGG + Intronic
1138810138 16:60139782-60139804 GTGTGCCTAGGCATGGAGCTAGG + Intergenic
1139550922 16:67672586-67672608 GTGTGGATAGGGAGGGATCTTGG + Intergenic
1139917539 16:70437953-70437975 CTGGGGGCAGGCAGGGACCTGGG - Intronic
1140888254 16:79263122-79263144 CTGGGACTAGGCAGTGAACTAGG + Intergenic
1141370023 16:83478377-83478399 CTGTGGTCAGACTGGGAGCTGGG - Intronic
1141648447 16:85379674-85379696 CAGTGGCCTGGCAGGGAGCAGGG - Intergenic
1141983757 16:87566166-87566188 CTGTGACTGGACAGGAAGCTTGG + Intergenic
1142051727 16:87963183-87963205 CTGGGGATGGGCTGGGAGCTTGG + Intronic
1142284698 16:89167005-89167027 CTGTGGCTGGGGATGGGGCTGGG - Intergenic
1142577844 17:921287-921309 CTGTGGTGAGTCAGGGAGCTTGG - Intronic
1142876216 17:2853449-2853471 CTCTGCCTGGGGAGGGAGCTCGG + Intronic
1142907206 17:3052047-3052069 CTATGGCTAGTTAAGGAGCTTGG - Intergenic
1142927362 17:3252209-3252231 CTATGGCTAGTTAAGGAGCTTGG + Intergenic
1143038580 17:4015845-4015867 TTGTGCCTGGGCAGGGAGGTAGG - Intronic
1143375235 17:6463357-6463379 CTGTGGCTGGGCTGTGTGCTGGG - Intronic
1143461617 17:7108034-7108056 CTGTGGCAGTGCAGGGAGCCTGG - Intronic
1143605436 17:7982143-7982165 CTGTGTCTAGGCAGCGGGCAAGG - Intergenic
1143632587 17:8147514-8147536 CAGTGTCCAGGGAGGGAGCTGGG + Exonic
1143962361 17:10731280-10731302 CCGGGACTAGGCAGGGAGCCTGG + Intergenic
1144830552 17:18128665-18128687 CTGTGGCCAGGCACAGTGCTGGG + Intronic
1144852407 17:18250724-18250746 AGGTGGGCAGGCAGGGAGCTGGG - Intronic
1145761325 17:27426769-27426791 CTGTGGCTGGGGAGGCAGCCTGG - Intergenic
1146956663 17:36940001-36940023 CTGGGGCTTGGCGGGTAGCTTGG + Intronic
1147484532 17:40799734-40799756 CTGTGCCTTGGGAGGGGGCTTGG - Exonic
1148469583 17:47884926-47884948 CGGTGGGTAGGGAAGGAGCTGGG - Intergenic
1148857926 17:50589174-50589196 GTGTGGCCAGGCAGAGGGCTGGG - Intronic
1148965858 17:51435510-51435532 CTGTGTCTAGGCAGCGGGCAAGG + Intergenic
1149504488 17:57182910-57182932 CTGTCTCTAGGCAAAGAGCTGGG - Intergenic
1149505522 17:57190612-57190634 CTGTGGCTGGGCTGGGGACTTGG + Intergenic
1149883927 17:60321244-60321266 CAGTGGCTAGACTGGGACCTGGG - Intronic
1150488003 17:65557390-65557412 ATGTGGCTAGGGAGGCAGCTGGG - Intronic
1150653546 17:67025019-67025041 CTGGTGCTGGGCCGGGAGCTGGG + Intronic
1151122491 17:71808419-71808441 GTGTGGCAAGGCAGGGACCCTGG - Intergenic
1151535466 17:74736840-74736862 AGGTGGCGAGGCGGGGAGCTGGG - Intronic
1151620810 17:75243768-75243790 CTGTGGATAGGCAGGGGGCCAGG + Intronic
1151934477 17:77253696-77253718 CTGTTGCTAGGTCGGGAGTTGGG + Intergenic
1151942288 17:77300395-77300417 CTGTGTCTAGGCAGGGGGTGGGG + Intronic
1152276763 17:79362541-79362563 CTGTGGCTTGGGATGGAGATGGG + Intronic
1152457217 17:80423391-80423413 CTGTGGACAGGCAGAGGGCTGGG - Intronic
1152461916 17:80446073-80446095 CTGTGGCCAGGCAGGGACTGGGG - Intergenic
1153200508 18:2642952-2642974 CTGTGGCTTTGCTGGGAGTTTGG + Intergenic
1154316608 18:13309234-13309256 CTCTGGCTTTGCTGGGAGCTGGG + Intronic
1156083725 18:33374039-33374061 CTGTCCCTTGGCAGAGAGCTTGG - Intronic
1158482986 18:57838065-57838087 CTCTGTCTAGGCAGTGAGCAGGG + Intergenic
1159320294 18:66839140-66839162 ATGTGCCTAGGCATGGAGCTGGG - Intergenic
1159404104 18:67977470-67977492 GTGTGGCCAGGCAGGGACCCTGG + Intergenic
1159723199 18:71919424-71919446 ATGTGCCTAGGCATGGAGCTGGG - Intergenic
1160577399 18:79864329-79864351 CTGGGGCTGGGCTGGGATCTGGG + Intronic
1161027446 19:2043083-2043105 CTGTGAGGAGGGAGGGAGCTGGG - Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161323917 19:3653862-3653884 CTGTGGGCAGGCAGGGAGTGTGG - Intronic
1161586360 19:5107917-5107939 ACGTGGCTCTGCAGGGAGCTGGG - Intronic
1161950139 19:7463337-7463359 CTGTGGCCAGGCACAGAGGTGGG - Intronic
1162345399 19:10115432-10115454 CTGGGACAAGGCAGGGAGCAGGG + Intronic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162911015 19:13847758-13847780 ATGTGGGGAGCCAGGGAGCTGGG - Intergenic
1163324436 19:16594150-16594172 GTGTGGCAAGGCAGGGAGAGTGG + Intronic
1163553814 19:17981642-17981664 GTGGGGCTGGGCAGGGAGCGCGG + Intronic
1164555241 19:29246231-29246253 CTCCCGCTAGGCAGGGAGATGGG - Intergenic
1164715607 19:30388355-30388377 GTGGGGTTAGGCAGGGGGCTTGG + Intronic
1165086468 19:33351526-33351548 CTGAGGATGGGCAGGGAGCAGGG + Intergenic
1165113616 19:33515779-33515801 GTGTGGCCAGGCAGGGAGAGGGG - Intronic
1165225611 19:34352704-34352726 CTGGGGCTGGGCAGCGTGCTGGG - Exonic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1166764056 19:45242108-45242130 CTGTGGCTCTGCAGGGCTCTTGG - Intronic
1167042238 19:47028889-47028911 CTGGGGGTAGGCAGAGACCTGGG - Intronic
1167286040 19:48599442-48599464 CTGTGGCAGGGCAGGCAGCGGGG + Intergenic
1168272465 19:55257826-55257848 CTGAGGGCAGGCAGGGAGCCTGG - Intronic
1168327050 19:55543870-55543892 TCGTGGAAAGGCAGGGAGCTGGG - Intronic
925954949 2:8954517-8954539 TTGTGCCTAGGCATGCAGCTGGG + Intronic
926200434 2:10792406-10792428 CTGTTGCCAGGCAGGGTGCAGGG + Intronic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
926420216 2:12688422-12688444 CTGGAGCTAGGCAGTGAGCCTGG - Intergenic
927077033 2:19589020-19589042 CTGGGGCAAGGCAGGGACCTGGG - Intergenic
927714383 2:25342380-25342402 CTGCGGCGAGGCCCGGAGCTCGG - Intronic
928035828 2:27822197-27822219 CTATGGCTAAGCAGGGAACAGGG + Intronic
928683464 2:33726364-33726386 CTCTGGCAAGGCAGAGTGCTAGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928945603 2:36769287-36769309 ATTTGGCTACGCTGGGAGCTTGG + Intronic
929037610 2:37709533-37709555 GTGAGGCAAGGCAGGGTGCTAGG + Intronic
930031107 2:47058573-47058595 CTTTTGCTAGGCAGGGTTCTTGG + Intronic
930079855 2:47436791-47436813 CTGTGCCTATACAGGGAGGTTGG - Intronic
930914685 2:56672437-56672459 GTGAGCTTAGGCAGGGAGCTGGG + Intergenic
931125418 2:59270998-59271020 CTGTGCATAGGCAGAGTGCTTGG - Intergenic
931901331 2:66791611-66791633 CAGAGGCTAGGTGGGGAGCTTGG + Intergenic
932046694 2:68357096-68357118 ATGGGGCTGGACAGGGAGCTAGG + Intergenic
932119486 2:69085147-69085169 CTGGGGATAGCCAGGCAGCTTGG - Intronic
932289553 2:70565160-70565182 CTGTGTCCAGGCAGTGAGATTGG - Intergenic
932565210 2:72901849-72901871 GTGTGGCAAAGCAGGGAGGTGGG - Intergenic
934298528 2:91762405-91762427 CTGTGGCTAGGCCGAGAGGGAGG + Intergenic
935368048 2:102315279-102315301 CTGTGGGTAGACAGGGAGAGTGG - Intronic
936966583 2:118133180-118133202 CTGTGGCTATGCAGGTTGATTGG + Intergenic
938137220 2:128769539-128769561 CTGTGGCTAGGCATAGAGCAGGG + Intergenic
940491557 2:154368538-154368560 CTGTGCACAGGCAGGGAGGTGGG + Intronic
940693970 2:156956033-156956055 GTGTGCCTAGTCATGGAGCTGGG + Intergenic
942152821 2:173094675-173094697 CTCTGACTAGGCTGGGGGCTGGG - Intronic
945935631 2:215900298-215900320 CTGAGGCAAGGCAGAGAACTGGG + Intergenic
946180143 2:217944004-217944026 CTGTGTCCAGGCAGGGAGCGGGG + Exonic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946727087 2:222671636-222671658 CAGAGGCTAGGCAGCGAGCGGGG - Intergenic
947343431 2:229164741-229164763 CTGTTTCAAGGCAGGAAGCTGGG - Intronic
947819182 2:233058899-233058921 CTCTGGCCAGGCTGGGAGCCAGG - Intergenic
948566131 2:238887604-238887626 CTGTGGTTAGGCAGGGCCATAGG + Intronic
948809269 2:240466573-240466595 CTGCGGCGGTGCAGGGAGCTGGG - Exonic
948859791 2:240747210-240747232 CTGGGACTCGGGAGGGAGCTTGG + Intronic
948922686 2:241073127-241073149 CTGGGGCCACGCAGGGAGCCTGG + Intronic
1168854165 20:997239-997261 CAGTGGCTGGGCAGGGGGGTTGG + Intronic
1169930942 20:10832428-10832450 CTGGGGGTTGCCAGGGAGCTGGG - Intergenic
1170633799 20:18087429-18087451 CTGTGGCTCGGAGGGGACCTGGG + Intergenic
1170905883 20:20514930-20514952 GTGTGCCTAGACATGGAGCTGGG - Intronic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1172162803 20:32880058-32880080 AGGTGGCCAGGCAGGGAGCTGGG + Intronic
1172246216 20:33446859-33446881 CTGGGGCTTGGCAGGGAGCCGGG - Intergenic
1172531680 20:35635420-35635442 AGCTGGCTGGGCAGGGAGCTGGG - Intronic
1172748889 20:37235546-37235568 CTGTGACTAGGAAGGGAGCAAGG - Intronic
1172754061 20:37271043-37271065 CAGGAGCTAGGCAGGGAGCCAGG - Intergenic
1173850647 20:46215862-46215884 CTGGGGCTGGGCTGGGAGATTGG + Intronic
1174513657 20:51074994-51075016 CTGGGTAGAGGCAGGGAGCTAGG - Intergenic
1174686842 20:52464671-52464693 CTCTGGCAGGGCTGGGAGCTAGG + Intergenic
1174754441 20:53143784-53143806 CTGTGTCTAGGCAGTGGGCAAGG - Intronic
1174852477 20:54008245-54008267 GTGGGGCTAAGTAGGGAGCTGGG + Intronic
1175405505 20:58723400-58723422 CTCTCCCCAGGCAGGGAGCTGGG - Intergenic
1175821851 20:61914237-61914259 CTGTGGCCACACAGGTAGCTGGG + Intronic
1175825095 20:61932336-61932358 CAGTGCCCAGGCAGTGAGCTGGG + Intronic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1176000012 20:62827454-62827476 CTGGGGCCAGGGAGAGAGCTCGG - Intronic
1176369992 21:6056806-6056828 CTGTGGCCAGGCATGAAGCCTGG + Intergenic
1179753527 21:43481735-43481757 CTGTGGCCAGGCATGAAGCCTGG - Intergenic
1179807938 21:43851936-43851958 CTGTGACTACGGAGGGACCTAGG - Intergenic
1180105676 21:45616690-45616712 CTGTGGGTAGGCGTGGATCTCGG - Intergenic
1180980705 22:19876818-19876840 CTGTGGCCAGGCCGGGGTCTGGG + Intronic
1181001218 22:19988631-19988653 CAATGGCAAGGCAGGTAGCTGGG - Intronic
1181461664 22:23089442-23089464 CTGCTGCTAGGCATAGAGCTGGG - Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182543318 22:31057399-31057421 CTCTTGCTGGGCAAGGAGCTAGG + Intergenic
1182804108 22:33056486-33056508 CTGGTCCTAGGGAGGGAGCTAGG - Intronic
1182847072 22:33440073-33440095 CTGTGGCTAGGTAGGCAGAATGG - Intronic
1183474151 22:38026729-38026751 CTGTGCCCAGGCAGGCTGCTGGG + Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183608024 22:38878232-38878254 CTGTGACTAGCCACTGAGCTTGG + Intergenic
1183730574 22:39616305-39616327 CTGTGGCAAGGCTGGGGTCTGGG + Intronic
1183933374 22:41248585-41248607 GTGTGGCTGGTCAGGGCGCTTGG + Intronic
1184110172 22:42389645-42389667 CTGTGGCTGGGCTGGGTGTTGGG + Intronic
1184156964 22:42674212-42674234 CAGTTGCTAGGTAGGGAGCCAGG - Intergenic
1184344015 22:43901948-43901970 CGGTGGCTTGGCTCGGAGCTGGG - Intergenic
1184588020 22:45460797-45460819 GTGGGGCCAGGCAGGCAGCTTGG - Intergenic
950032399 3:9861681-9861703 CTGTGGCCAGGCAGGGGGCAGGG - Intergenic
950113843 3:10438027-10438049 CTGAGGCTCTGCAGGGAGCCAGG + Intronic
950158809 3:10743648-10743670 CTGAGGCTGGGCAGGGCCCTAGG + Intergenic
950676202 3:14555832-14555854 CTGAGGACAGGCAGGGAGCCTGG + Intergenic
950888238 3:16379393-16379415 CTATGTCTAGGCATTGAGCTAGG + Intronic
951194062 3:19804299-19804321 GTGTGCCTAGGCATGGAGCTGGG - Intergenic
952640134 3:35583813-35583835 CAGTGGCTGGGAAGGGTGCTAGG + Intergenic
952748692 3:36805971-36805993 CTTTTTCCAGGCAGGGAGCTGGG + Intergenic
952994084 3:38860312-38860334 CTCTGACTAGGCAGGGGGCAAGG + Intronic
953880635 3:46689634-46689656 CTGGGCCTAGGCAGGGAGCAGGG - Intronic
954364401 3:50138561-50138583 CTGCAGGGAGGCAGGGAGCTGGG - Intergenic
954445160 3:50542425-50542447 GTGGGGCTAGGAAGGGAGCCAGG + Intergenic
954695827 3:52425227-52425249 CAGTGGGTAGAAAGGGAGCTTGG + Intergenic
954794600 3:53155106-53155128 CAGTGGCTAGGCAGGCGGCCAGG - Intergenic
955069197 3:55558131-55558153 CTGTGACTAGGCAGAGAGGCAGG - Intronic
955857104 3:63284528-63284550 CCTTGGTTAGGCAGGGAGGTAGG - Intronic
956680141 3:71771338-71771360 GAGTGGTTAGGCAGGGTGCTAGG - Intergenic
957071631 3:75572107-75572129 CTGTGGCTGGGCACTGGGCTAGG - Intergenic
958823930 3:99007536-99007558 GTGTGCCTAGGCATGGAGCTGGG + Intergenic
960404148 3:117238846-117238868 CTGTGGCCAAGCAGGTATCTAGG - Intergenic
960711684 3:120536749-120536771 CAGTGGCTAGTCTGGGACCTTGG + Intergenic
961560990 3:127730225-127730247 CTGGGGTTGGGCAGGGAGATTGG - Intronic
962506580 3:136052334-136052356 CTGTGCCGAGGCAGAGAGCAGGG - Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
963968258 3:151398725-151398747 CTGTGGATAAGCAGGGTGATAGG - Intronic
964919197 3:161875454-161875476 GTGTGCTTAGGCATGGAGCTGGG - Intergenic
966640669 3:182186280-182186302 CTGTTGTGAGGTAGGGAGCTAGG - Intergenic
966884159 3:184366106-184366128 TTGTGTCTTGGGAGGGAGCTTGG + Intronic
967915469 3:194575122-194575144 CTGTGTCTAGGCAGCGGGCAAGG - Intergenic
968699645 4:2048419-2048441 CTGTGGCTGGGCAGGGACCCTGG + Intergenic
968880427 4:3295976-3295998 CAGTGCCTCGGGAGGGAGCTTGG - Intronic
968951933 4:3699897-3699919 CTGGGGCCAGGCAGGAACCTTGG + Intergenic
968983878 4:3865143-3865165 CTGGGCCCAGGCAGGGAGGTGGG - Intergenic
969015224 4:4099418-4099440 CTGTGGCTGGGCACTGGGCTAGG - Intergenic
969384539 4:6835614-6835636 CTGTTGGGAGGCGGGGAGCTGGG - Intronic
969455749 4:7298785-7298807 CTGTGCCCAGGCCGGGTGCTGGG + Intronic
969869496 4:10095838-10095860 CTGTGGCCTGGCACAGAGCTAGG - Intronic
969896327 4:10308365-10308387 CTGTGGCTTGGCAGCTAGTTAGG + Intergenic
970869366 4:20797752-20797774 CTGTGGGTCGGCAGGGAATTAGG + Intronic
971066096 4:23035173-23035195 GTGTGCCAAGGCATGGAGCTGGG + Intergenic
971316469 4:25572126-25572148 CTGAGGCTTGACAGGGAGTTGGG - Intergenic
974111437 4:57530458-57530480 CTATGACTAGACAGGGAGGTGGG + Intergenic
974126773 4:57706624-57706646 GTGTGACTAGGCATGGAGCTGGG + Intergenic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
979076148 4:116274226-116274248 CTGTGGCTAGTCAGCAATCTTGG - Intergenic
979139394 4:117153051-117153073 GAGTGCCTAGGCATGGAGCTGGG + Intergenic
979308112 4:119172219-119172241 CTCTGTCTAGGCAGGGGGCAAGG - Intronic
981004363 4:139860151-139860173 CTGCGGCTTGGGAGGGAGCTAGG - Intronic
981089934 4:140721949-140721971 CTGAGGCTAGGCATGGAGTCTGG - Intronic
982647119 4:158037774-158037796 GTGTGCCTAGGTATGGAGCTAGG - Intergenic
982843709 4:160223829-160223851 GTGTGCCTAGGCATGGAGCTGGG + Intergenic
983474410 4:168196372-168196394 GTGTGCCTAGGCATGGAGCTGGG - Intergenic
985511624 5:317145-317167 GTGTGGCTGGGCAGGGGGCACGG - Intronic
985758304 5:1732314-1732336 CTCTGTCTAGGCAGGGGGCAAGG + Intergenic
985996484 5:3600011-3600033 CCGTGGCTAGGCAGGAAGGCGGG - Exonic
986709871 5:10480871-10480893 CTGTGGGTGGGCAGGGAGCTAGG - Intergenic
986793646 5:11188445-11188467 CTGGGGCCAGTCAGGGAGTTGGG + Intronic
987582923 5:19819876-19819898 GAGTGGCCAGGCAGGGACCTCGG - Intronic
988355749 5:30171790-30171812 CTGTTGGAGGGCAGGGAGCTAGG + Intergenic
991496669 5:67233435-67233457 CTCTGTCTAGGCAGGGGGCAAGG + Intergenic
991559515 5:67934817-67934839 CTGTGACCAGGCAGAGAGCAGGG - Intergenic
992027178 5:72681707-72681729 CTGGGACTAGGGAGCGAGCTGGG - Intergenic
992791022 5:80213763-80213785 ATTTGGTGAGGCAGGGAGCTTGG - Intronic
993009135 5:82459582-82459604 CTGTGCCTAGGCGTGGAACTGGG - Intergenic
993279776 5:85910215-85910237 GTGTGCCTAGGCATGGAACTGGG + Intergenic
993731009 5:91423023-91423045 CTGTGGCTTGGCACTGGGCTTGG + Intergenic
993877626 5:93326765-93326787 GTGGGGCTAGGCAGGGAGATAGG - Intergenic
995299250 5:110558545-110558567 GTGTGGTAAGGCAGGGACCTGGG + Intronic
997510709 5:134451903-134451925 CTGTGGCCAGCCAGGGAGGATGG + Intergenic
997692157 5:135834224-135834246 CCAGGGCCAGGCAGGGAGCTGGG + Intergenic
999314471 5:150575143-150575165 CTGTGGCCAGACAGAGAGCAGGG - Intergenic
999314703 5:150576120-150576142 TTGTGGCTTGTCAGGGAGCTGGG + Intergenic
999373506 5:151070506-151070528 CTGTGGTTAAGCAGGGTGCCTGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999591175 5:153148276-153148298 ATGTGCCTAGGCATGGAGCTGGG - Intergenic
999779110 5:154834986-154835008 CTGTGCCTCAGCAGTGAGCTGGG - Intronic
1000569610 5:162895704-162895726 GTGTGGCCAGGCAGGGACCCTGG - Intergenic
1001297172 5:170506160-170506182 CTGTGGCTCTCCTGGGAGCTGGG + Intronic
1001303092 5:170552267-170552289 CTGTGGCCAGGCACAGGGCTGGG + Intronic
1001649057 5:173302328-173302350 CCGTGGGGAGGCAGGGAGCTTGG + Intergenic
1001686734 5:173598997-173599019 TTGTGGGGAGGCAGGAAGCTGGG + Intergenic
1001846415 5:174925795-174925817 CTGGGGTGAGGAAGGGAGCTTGG - Intergenic
1001877914 5:175216947-175216969 CTGTGCCAAGGCAGGGAGATGGG + Intergenic
1001961055 5:175880549-175880571 CTCTGGCCAGGCTGGGATCTGGG + Exonic
1002373832 5:178774674-178774696 ATGTGGCGGGGCAAGGAGCTGGG - Intergenic
1002762414 6:212103-212125 GTGTGGCTGGACAGAGAGCTGGG + Intergenic
1003122579 6:3330069-3330091 CTGGGGCTGGGCAGGGCGGTGGG - Intronic
1003449911 6:6221112-6221134 CTGTGGTCAGGCATTGAGCTAGG - Intronic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1006403567 6:33831530-33831552 CTATGGGTGGGCAGGGAGCTGGG - Intergenic
1006986313 6:38178023-38178045 CTGTGGCTCTGCAAGGAACTGGG + Intronic
1007530731 6:42539863-42539885 CTGTGGGGAGACAGGGAGTTGGG - Intergenic
1009849688 6:69180083-69180105 GTGTGGCAAGGCATGGAGCTGGG + Intronic
1010024307 6:71197923-71197945 CTGTGTCTAGACAGGCAGCCTGG - Intergenic
1010475004 6:76276180-76276202 GTGTGCCTAGACATGGAGCTGGG + Intergenic
1011551339 6:88533682-88533704 ATGAGGCTAGGGAGGGGGCTGGG - Intergenic
1013190812 6:107803106-107803128 CTGGGCCAAGGCAGGCAGCTGGG - Intronic
1013761090 6:113518639-113518661 CTGTGTCTAGGCAGTGGGCAAGG + Intergenic
1014826768 6:126055945-126055967 TTGTCTCAAGGCAGGGAGCTGGG - Intergenic
1015311569 6:131772732-131772754 CTCTGTCTAGGCAGTGAGCAAGG - Intergenic
1015376483 6:132515899-132515921 CTGTGTATATGCAGGGGGCTTGG - Intergenic
1015690639 6:135918213-135918235 CTGTGCCTAGACAGAGAGCTGGG + Intronic
1015950058 6:138543626-138543648 CTGTGGCTAGCCAAGGTCCTAGG - Intronic
1018246584 6:161829956-161829978 CCGTAGCTTGGCCGGGAGCTGGG + Intronic
1018313180 6:162531298-162531320 CTCTGTCTAGGCAGCGAGCAAGG - Intronic
1018560688 6:165098475-165098497 CTCTGGTTAGGAAGGGAGGTGGG - Intergenic
1019641359 7:2105468-2105490 CTGGGGCAAGGCAGGGAGCGTGG + Intronic
1020763819 7:12296969-12296991 CTGTGTCTAGGCAGTGGGCAAGG + Intergenic
1021124548 7:16836356-16836378 CTCTGTCTAGGCAGTGGGCTAGG - Intergenic
1021194983 7:17665117-17665139 CAGGGGCTGGGCAGGGAGCCAGG - Intergenic
1021892217 7:25196776-25196798 ATGAGGCTAGAAAGGGAGCTGGG + Intergenic
1022866426 7:34426364-34426386 CTGATGCTAGGTAGGCAGCTGGG - Intergenic
1023408199 7:39858980-39859002 CTTTGTCAAGTCAGGGAGCTGGG + Intergenic
1023497621 7:40815298-40815320 GTGTGCCTAGGCATGGTGCTGGG + Intronic
1023773715 7:43583424-43583446 CTGTGCCCGGGCCGGGAGCTGGG + Exonic
1024770342 7:52714518-52714540 GTGTGGCTAGGCAGTGGGCAAGG - Intergenic
1025137662 7:56433551-56433573 CTTTGTCAAGTCAGGGAGCTGGG - Intergenic
1025260586 7:57415096-57415118 CTGTGCAGAGGAAGGGAGCTGGG + Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1026084075 7:67248589-67248611 CTCTGTCTAGGCAGGGGGCAAGG - Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028333319 7:89622975-89622997 GTGTGCCTAGGAATGGAGCTGGG - Intergenic
1028868452 7:95738840-95738862 GTGTGCCTTGGCATGGAGCTGGG - Intergenic
1029458056 7:100680844-100680866 ACGTGGCAAGGCAGAGAGCTGGG + Exonic
1030723559 7:112898446-112898468 CTGTGGCTGGGCTGGTACCTGGG - Intronic
1030754259 7:113269131-113269153 TTGTGCCTAGGCATGGAGTTGGG - Intergenic
1030961103 7:115924286-115924308 CTGTCTCAAGGCAGTGAGCTGGG - Intergenic
1031166151 7:118229465-118229487 CTATGGCTAGGCAGGGTTCTAGG - Intronic
1031256086 7:119450496-119450518 GTGTGGCCAGGCAGAGACCTTGG + Intergenic
1031904671 7:127447312-127447334 GTGTGCCTAGGCATGGAGCAGGG - Intergenic
1033244802 7:139708598-139708620 CTGTGGCAAGGCAGAAAACTGGG + Intronic
1034315614 7:150128880-150128902 CTTTCTCTAGGCAGTGAGCTGGG - Intergenic
1034533378 7:151711858-151711880 CTGTGGCTAGGAAGAGTCCTGGG - Intronic
1034791275 7:153971925-153971947 CTTTCTCTAGGCAGTGAGCTGGG + Intronic
1034998233 7:155591779-155591801 GTGTGGCTATGGAGAGAGCTTGG - Intergenic
1035309254 7:157954696-157954718 CTGGGGCTCGGCAGGGAGGCGGG - Intronic
1035475327 7:159139812-159139834 CTGTGCCTAGGCAGGAAGCCTGG + Intronic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1037225728 8:16587289-16587311 CTGTGGTCAGTCAGGGATCTTGG + Intergenic
1037820434 8:22132384-22132406 CTGTGGCAAGGCAGGCTGGTAGG + Intronic
1038363524 8:26907491-26907513 CTGAGGCTAGGCCTGGATCTAGG + Intergenic
1039759370 8:40558161-40558183 CTGAGCCAAGGCAGGGAGGTAGG + Intronic
1039839860 8:41285755-41285777 CTGGGGTGAGGCAGGGACCTAGG + Intronic
1040088668 8:43372045-43372067 CTTTGTCAAGTCAGGGAGCTAGG + Intergenic
1040464391 8:47680368-47680390 CTGTGACTGGGCAGGATGCTGGG + Intronic
1043034559 8:75179426-75179448 ATGTGCCTATGCATGGAGCTGGG - Intergenic
1043213101 8:77550540-77550562 TTGTGCCTAGTCATGGAGCTGGG + Intergenic
1043521346 8:81048800-81048822 CTTTGTCCAGGCAGGGAGATGGG - Intronic
1043562770 8:81514115-81514137 CAGTGGCCATGCAGGGAGCAGGG - Intergenic
1043655704 8:82662789-82662811 GTGTGCCTAGGCATGGAGCTGGG + Intergenic
1043889920 8:85643668-85643690 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043891458 8:85655576-85655598 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043892531 8:85662413-85662435 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043893026 8:85714922-85714944 CTGAGGCCGGGCATGGAGCTGGG - Intergenic
1043895713 8:85736376-85736398 CTGAGGCCGGGCATGGAGCTGGG - Intergenic
1043896966 8:85745432-85745454 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043899290 8:85763799-85763821 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043900900 8:85775993-85776015 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043902864 8:85791268-85791290 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043904474 8:85803461-85803483 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043906086 8:85815652-85815674 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043907694 8:85827842-85827864 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1044366127 8:91348002-91348024 CTGGTGCTCTGCAGGGAGCTCGG + Intronic
1044483637 8:92723672-92723694 CTGGGTCTAGCAAGGGAGCTAGG + Intergenic
1046073035 8:109281935-109281957 CTCTGCCTAGGCATGGAGCAGGG - Intronic
1048320934 8:133399760-133399782 CTGTGGCCAGACACAGAGCTGGG + Intergenic
1048692575 8:136984081-136984103 CTTAGGCTAGGCAGTGTGCTAGG - Intergenic
1049594700 8:143477959-143477981 CTGTGGGGAGGCAGGGAGCTGGG - Intronic
1049722153 8:144123376-144123398 CTGAGGCTGGGAAGGGAGGTGGG + Intergenic
1050077405 9:1879425-1879447 ATGTGACTAGAGAGGGAGCTGGG - Intergenic
1050295237 9:4197514-4197536 ATGTGCCTAGGCATGGAGCTGGG - Intronic
1050609022 9:7331868-7331890 CTGGGGCCAGGCAGGGAGAGAGG - Intergenic
1050618991 9:7433373-7433395 GTGTGCCTAGGCATGGAACTGGG + Intergenic
1050687823 9:8191193-8191215 GTATGCCTAGGCATGGAGCTGGG - Intergenic
1051262957 9:15283099-15283121 CTGTGGGTAGGCGTGGCGCTTGG - Intronic
1051852778 9:21528392-21528414 GTGTGGCCAGGCTGGGACCTAGG + Intergenic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053352982 9:37425324-37425346 CTGGGGCTTGGCACTGAGCTAGG - Intronic
1053614110 9:39745474-39745496 CTCTGTCTAGGCAGGGGGCAAGG + Intergenic
1053872140 9:42503416-42503438 CTCTGTCTAGGCAGGGGGCAAGG + Intergenic
1054239407 9:62596919-62596941 CTCTGTCTAGGCAGGGGGCAAGG - Intergenic
1054553538 9:66631446-66631468 CTCTGTCTAGGCAGGGGGCAAGG - Intergenic
1056109946 9:83384938-83384960 CTCTGGCTGAGCTGGGAGCTGGG + Intronic
1057102643 9:92377487-92377509 CTGTGGCCAGGTAGGGAGTGTGG + Intronic
1057592138 9:96381825-96381847 CTGTGCCTGGGCGGGGAGGTAGG - Intronic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1057880726 9:98790950-98790972 CTGTGGCCAGGCACAGAGCCAGG - Intronic
1057883139 9:98808136-98808158 CAGTGGCAGGGCGGGGAGCTGGG + Intronic
1058558511 9:106198502-106198524 CTGGGGCCTGTCAGGGAGCTGGG - Intergenic
1059376420 9:113885115-113885137 CTGTGGCTAGGCAGCTGGATTGG + Intronic
1059510374 9:114839609-114839631 GTGTGGCCAGGCAGGGACCCTGG - Intergenic
1060038825 9:120282143-120282165 CTGTGGTTGGGAAGGCAGCTTGG - Intergenic
1060042560 9:120311891-120311913 CGGCGGCTAGGCAGAGTGCTAGG - Intergenic
1060493268 9:124100342-124100364 TGGTGGCTTGGGAGGGAGCTGGG - Intergenic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1060797114 9:126520185-126520207 CTGTGGATGGGCAGTGGGCTGGG - Intergenic
1061216353 9:129224149-129224171 CTGGGCCCAGGCAGGGTGCTGGG + Intergenic
1061218992 9:129238019-129238041 CAGAGGCCAGGCAGGGAGGTGGG - Intergenic
1061596525 9:131633745-131633767 TTCTGTCTAGGCAGGGAGATAGG - Intronic
1061664979 9:132155368-132155390 CTGTGGCTGGGAGGAGAGCTGGG + Intergenic
1061880373 9:133565950-133565972 CTGCTCCTGGGCAGGGAGCTGGG + Intronic
1062010347 9:134263658-134263680 CTGGGCCTAGGCCGTGAGCTGGG + Intergenic
1062013241 9:134277976-134277998 CTGTGGCAGGGCAGGGGACTTGG + Intergenic
1062254495 9:135614672-135614694 CTGGGCCCAGGCAGGGAGCAGGG + Intergenic
1062304243 9:135894035-135894057 CTGTTGCTAGGCAGGGAGTCAGG - Intronic
1062405749 9:136395497-136395519 CAGAGGAGAGGCAGGGAGCTGGG + Intronic
1062491293 9:136806296-136806318 CTGCAGCCAGGCTGGGAGCTGGG + Intronic
1062613818 9:137387158-137387180 CGGGGGCCAGGCAGGGAGCGGGG - Intronic
1062745749 9:138210962-138210984 CTGCGGCCAGACAGGGAGCAGGG - Intergenic
1185974980 X:4710232-4710254 CTCTGTCTAGGCAGGGGGCAAGG + Intergenic
1186076702 X:5887465-5887487 CAGAGGCAAGGCAGGGAGTTTGG - Intronic
1187112267 X:16314036-16314058 CTGTGTCTAGGCAGCGGGCAAGG - Intergenic
1188805982 X:34590490-34590512 GTGTGCCTAGGCATGGAGGTGGG + Intergenic
1189619624 X:42821787-42821809 CTCTGTCTAGGCAGGGGGCAAGG - Intergenic
1189795973 X:44646375-44646397 CTCTGTCTAGGCAGCGAGCAAGG - Intergenic
1190368680 X:49721397-49721419 CTCTGTCTAGGCAGTGGGCTAGG + Intergenic
1191253401 X:58269756-58269778 CTGAGGCAAAGCAGGAAGCTGGG - Intergenic
1192098173 X:68235492-68235514 CTGTTGCTGGGCAGGAAGCTAGG + Intronic
1193165650 X:78277271-78277293 GTGTGGCCAGGCAGGGACCCTGG - Intronic
1193774774 X:85628306-85628328 GTGTGCCTAGGCATGAAGCTGGG + Intergenic
1194333423 X:92614742-92614764 GTGTGTCTAGGCATGGAGCTGGG + Intronic
1194659041 X:96608359-96608381 CTGTGGCTTGGCATGGGGCAAGG - Intergenic
1195667051 X:107441018-107441040 ATGTGGCTAGGCAGAGAGGGTGG + Intergenic
1195734843 X:108001357-108001379 GTGTGCCTAGGCATGGTGCTGGG - Intergenic
1197546649 X:127833288-127833310 TAGAGGCTAGGCAGGGAGGTGGG - Intergenic
1198425396 X:136514369-136514391 CTGAGGCTTGGCAGGAAGGTAGG + Intergenic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1199322429 X:146456014-146456036 GTGTACCTAGGCATGGAGCTGGG - Intergenic
1199827830 X:151516903-151516925 CTGTGGCTAGGCAGGGACCTTGG + Intergenic
1200247405 X:154533504-154533526 CTGTGACGAGGCACTGAGCTGGG - Intronic
1200642108 Y:5733748-5733770 GTGTGTCTAGGCATGGAGCTGGG + Intronic
1201294022 Y:12448322-12448344 CTCTGTCTAGGCAGGGGGCGAGG + Intergenic