ID: 912474680

View in Genome Browser
Species Human (GRCh38)
Location 1:109928028-109928050
Sequence TACTGGGTAAGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912474680_912474694 3 Left 912474680 1:109928028-109928050 CCATCTTCCCTCCTTACCCAGTA No data
Right 912474694 1:109928054-109928076 CCTATGGATGTTAGGGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 148
912474680_912474692 0 Left 912474680 1:109928028-109928050 CCATCTTCCCTCCTTACCCAGTA No data
Right 912474692 1:109928051-109928073 GGGCCTATGGATGTTAGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 181
912474680_912474690 -4 Left 912474680 1:109928028-109928050 CCATCTTCCCTCCTTACCCAGTA No data
Right 912474690 1:109928047-109928069 AGTAGGGCCTATGGATGTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 69
912474680_912474691 -1 Left 912474680 1:109928028-109928050 CCATCTTCCCTCCTTACCCAGTA No data
Right 912474691 1:109928050-109928072 AGGGCCTATGGATGTTAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 103
912474680_912474689 -5 Left 912474680 1:109928028-109928050 CCATCTTCCCTCCTTACCCAGTA No data
Right 912474689 1:109928046-109928068 CAGTAGGGCCTATGGATGTTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
912474680_912474695 15 Left 912474680 1:109928028-109928050 CCATCTTCCCTCCTTACCCAGTA No data
Right 912474695 1:109928066-109928088 AGGGAGGGAGGCTCCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912474680 Original CRISPR TACTGGGTAAGGAGGGAAGA TGG (reversed) Intronic
No off target data available for this crispr