ID: 912475753

View in Genome Browser
Species Human (GRCh38)
Location 1:109933782-109933804
Sequence TGCCCAGGGCTTGCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912475753_912475766 19 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475766 1:109933824-109933846 TGGCTGTTCTCAGAGGAAGGTGG No data
912475753_912475764 16 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475764 1:109933821-109933843 GCCTGGCTGTTCTCAGAGGAAGG No data
912475753_912475767 28 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475767 1:109933833-109933855 TCAGAGGAAGGTGGCAGAGCTGG No data
912475753_912475758 -7 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475758 1:109933798-109933820 CTGGGCACCAGCATGCTACCAGG No data
912475753_912475768 29 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475768 1:109933834-109933856 CAGAGGAAGGTGGCAGAGCTGGG No data
912475753_912475763 12 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475763 1:109933817-109933839 CAGGGCCTGGCTGTTCTCAGAGG No data
912475753_912475759 -6 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475759 1:109933799-109933821 TGGGCACCAGCATGCTACCAGGG No data
912475753_912475760 -1 Left 912475753 1:109933782-109933804 CCCCTCTGGGCAAGCCCTGGGCA No data
Right 912475760 1:109933804-109933826 ACCAGCATGCTACCAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912475753 Original CRISPR TGCCCAGGGCTTGCCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr