ID: 912476285

View in Genome Browser
Species Human (GRCh38)
Location 1:109937771-109937793
Sequence TGACTACTGTTCACAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912476279_912476285 -6 Left 912476279 1:109937754-109937776 CCTGTTCACCCCTGCCCTGACTA No data
Right 912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG No data
912476277_912476285 -1 Left 912476277 1:109937749-109937771 CCATCCCTGTTCACCCCTGCCCT No data
Right 912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG No data
912476278_912476285 -5 Left 912476278 1:109937753-109937775 CCCTGTTCACCCCTGCCCTGACT No data
Right 912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG No data
912476276_912476285 0 Left 912476276 1:109937748-109937770 CCCATCCCTGTTCACCCCTGCCC No data
Right 912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG No data
912476275_912476285 6 Left 912476275 1:109937742-109937764 CCATTACCCATCCCTGTTCACCC No data
Right 912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG No data
912476274_912476285 7 Left 912476274 1:109937741-109937763 CCCATTACCCATCCCTGTTCACC No data
Right 912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912476285 Original CRISPR TGACTACTGTTCACAGCCTC TGG Intergenic
No off target data available for this crispr