ID: 912479328

View in Genome Browser
Species Human (GRCh38)
Location 1:109967782-109967804
Sequence TAAGTATGATGTTAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912479328_912479332 19 Left 912479328 1:109967782-109967804 CCCTGCAGCTAACATCATACTTA No data
Right 912479332 1:109967824-109967846 CTTCCTATAAGATCAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912479328 Original CRISPR TAAGTATGATGTTAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr