ID: 912480719

View in Genome Browser
Species Human (GRCh38)
Location 1:109980524-109980546
Sequence GGCCCTTAGGGACCCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912480719_912480726 5 Left 912480719 1:109980524-109980546 CCCTCTGGGGGTCCCTAAGGGCC No data
Right 912480726 1:109980552-109980574 GGTAGGTGACCAATCTGAAGTGG No data
912480719_912480729 15 Left 912480719 1:109980524-109980546 CCCTCTGGGGGTCCCTAAGGGCC No data
Right 912480729 1:109980562-109980584 CAATCTGAAGTGGTGCTCCAGGG No data
912480719_912480728 14 Left 912480719 1:109980524-109980546 CCCTCTGGGGGTCCCTAAGGGCC No data
Right 912480728 1:109980561-109980583 CCAATCTGAAGTGGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912480719 Original CRISPR GGCCCTTAGGGACCCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr