ID: 912481499

View in Genome Browser
Species Human (GRCh38)
Location 1:109985069-109985091
Sequence CGATGCCGCTGCCCGGGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912481490_912481499 16 Left 912481490 1:109985030-109985052 CCGCTGGCCGGGCCGGCCGGGGA 0: 1
1: 0
2: 3
3: 22
4: 213
Right 912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 94
912481491_912481499 9 Left 912481491 1:109985037-109985059 CCGGGCCGGCCGGGGAATGTCGA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 94
912481492_912481499 4 Left 912481492 1:109985042-109985064 CCGGCCGGGGAATGTCGATGCCT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 94
912481493_912481499 0 Left 912481493 1:109985046-109985068 CCGGGGAATGTCGATGCCTGACG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912481499 Original CRISPR CGATGCCGCTGCCCGGGGTC GGG Exonic
900003508 1:29157-29179 CGCGGCCGCTGCCCGGTGCCCGG - Intergenic
900023228 1:199673-199695 CGCGGCCGCTGCCCGGTGCCCGG - Intergenic
900569839 1:3352831-3352853 CAAGGCCTCTGCCCGGTGTCAGG + Intronic
901534441 1:9873109-9873131 GGAGGCTGCTGCCCGGGCTCTGG - Intronic
901705599 1:11070841-11070863 CGATGCCCCTGCTTGTGGTCAGG - Intronic
903263360 1:22142939-22142961 CGCAGCCGCTGCCCCGGGCCGGG - Exonic
905665348 1:39760317-39760339 CAATGCCCCGGCCTGGGGTCTGG + Exonic
912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG + Exonic
923463932 1:234231769-234231791 GGATGGAGCAGCCCGGGGTCAGG - Intronic
1069849613 10:71396713-71396735 CGGCGCCGCTCCCGGGGGTCCGG + Intergenic
1076554205 10:131311513-131311535 CGCCGCCGCCGCCCTGGGTCTGG - Exonic
1076767955 10:132646875-132646897 CGATGCAGCCACCCGGAGTCGGG + Intronic
1076878941 10:133230754-133230776 CGCCGCCGCTCCCCGGGGTCCGG + Exonic
1079147112 11:17862738-17862760 CGATGGTGCTGCCCAGGCTCAGG + Intronic
1082076728 11:47980836-47980858 CGACGACGGTGCCCGGGCTCGGG + Exonic
1083303800 11:61752678-61752700 CGATGCCGCGCCCCCGGGCCGGG + Exonic
1083904907 11:65663042-65663064 CACAGCCGCTGCCGGGGGTCGGG + Exonic
1084192254 11:67504542-67504564 GGATGCCGTTTCCCGGGGTTAGG - Intronic
1084554653 11:69868602-69868624 CGGGGCGGCTGCCCGGGGTGGGG - Intergenic
1085300751 11:75456911-75456933 CGCTGCCTCTGCCCAGGGTCAGG - Intronic
1089563351 11:119357026-119357048 CGAAGCCGCTGCCCGTGGGGAGG - Intronic
1089873923 11:121701754-121701776 CATTGCCGCTGCCCTGGTTCAGG - Intergenic
1091376927 12:31211-31233 CGCGGCCGCTGCCCGGTGCCCGG - Intergenic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1096481866 12:51947421-51947443 CATTGCTGCTGCCTGGGGTCAGG + Intergenic
1102035165 12:109766793-109766815 AGATGCCCCTGCCCGGCTTCGGG - Intronic
1104633572 12:130424507-130424529 CCAGGCCGCTGTCCGGGCTCCGG + Intronic
1104975223 12:132549162-132549184 CGTCGCCGCGGCCTGGGGTCTGG + Intronic
1112334663 13:98504388-98504410 CCATGCCTCTTCCCTGGGTCAGG + Intronic
1113592647 13:111512046-111512068 GGACGGCGCTGCCCGGGCTCGGG - Intergenic
1117131837 14:52695219-52695241 CGGTGCTGCTGCCCGGTGGCCGG - Intronic
1117135503 14:52730710-52730732 CGCTGCCCCTCCGCGGGGTCTGG - Intronic
1117478498 14:56119408-56119430 GGATGCGGCTGCTCGGGGCCTGG + Intronic
1117842052 14:59870451-59870473 CGACGCCGCTTCCCGGGCCCTGG + Exonic
1119529180 14:75347718-75347740 GGATGCTGCTGTCAGGGGTCAGG - Intergenic
1121473717 14:94175056-94175078 CGCTGACGCCGCCCGGGTTCTGG + Intronic
1123004029 14:105312934-105312956 TTATGCAGCTGCCAGGGGTCGGG - Exonic
1125300902 15:38252689-38252711 CGCCGCCGCTGCCCGGAGCCTGG + Exonic
1129515830 15:76156865-76156887 CGATGCTGCTGCCCAGCCTCAGG + Intronic
1131389661 15:92036495-92036517 CAATGCCGCTGCCCAGGGTGGGG - Intronic
1132186915 15:99808230-99808252 CGATCCCTCTCCCCGGGGCCTGG + Intergenic
1132428774 15:101744491-101744513 CGATCCCTCTCCCCGGGGCCTGG - Exonic
1132449993 15:101961783-101961805 CGCGGCCGCTGCCCGGTGCCCGG + Intergenic
1133271918 16:4614519-4614541 CGACGGCGGTGCCCGGCGTCCGG - Intronic
1142015852 16:87746910-87746932 CGTGGCAGCTGCCCTGGGTCTGG - Intronic
1142509538 17:385463-385485 CAAAGCCGCTTCCCGGAGTCGGG - Intronic
1149470833 17:56913985-56914007 CCATGGCGCTCCCAGGGGTCGGG + Exonic
1150311082 17:64129976-64129998 CGCTGCTGCTGCCCGGCCTCGGG - Exonic
1152654883 17:81514833-81514855 GGATGGCGCTGCCCCGGGCCGGG - Intronic
1160635261 19:70765-70787 CGCGGCCGCTGCCCGGTGCCCGG - Intergenic
1161924882 19:7293315-7293337 GGGTGACGCTGCCTGGGGTCAGG - Intronic
1162731778 19:12722476-12722498 CGCCGCTGCTGCCCGGGGCCGGG - Intronic
1162908364 19:13836550-13836572 CGAGGATGCTGCCCGGGGACGGG - Intergenic
1166076108 19:40414699-40414721 CTGTGCCGCCCCCCGGGGTCTGG - Intergenic
1166107753 19:40605733-40605755 CGTCCCCGCTGCCCGGGCTCCGG + Exonic
1167145836 19:47680523-47680545 CGATGCTGCTGCCTTGGTTCAGG - Exonic
1168348231 19:55661104-55661126 CAACGCCGGTGCCCGTGGTCGGG + Exonic
936566219 2:113584278-113584300 CGCGGCCGCTGCCCGGTGCCCGG + Intergenic
1172118509 20:32584855-32584877 CGCTGCTGCTGCGCGGGGGCTGG - Intronic
1173322260 20:41998701-41998723 CGGCGCCGCAGCCCTGGGTCTGG + Intergenic
1173762102 20:45571635-45571657 AGAGGCCGTTGCCAGGGGTCAGG - Intronic
1173788545 20:45812764-45812786 CGGGGGCGCCGCCCGGGGTCCGG + Exonic
1176308321 21:5135939-5135961 CGATACCACTGCCAGGCGTCAGG - Exonic
1179848739 21:44126093-44126115 CGATACCACTGCCAGGCGTCAGG + Exonic
1183586349 22:38755453-38755475 CGTAGGCGCTGCCCGGGGCCGGG + Intronic
1184095522 22:42314330-42314352 AGCTGCCGCTGCCGGGGGACAGG + Intronic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
1185121342 22:48973461-48973483 CGAAGCACCTGCCCGGGGGCTGG + Intergenic
1185420354 22:50731365-50731387 CGAGCCCGCGGCCCGGGGTGGGG - Intergenic
954618608 3:51983299-51983321 GGCGGCCGCTGCCCGGGGACGGG + Exonic
968135305 3:196216306-196216328 CGAAGCCCCTGCCCTGGGCCGGG - Intronic
984734898 4:183099517-183099539 AGCTGCCGCTGCCCCGGGGCTGG + Exonic
985895500 5:2748357-2748379 CGTAGCCGCCGCCCGGGGACCGG + Exonic
988882613 5:35519954-35519976 ACATGCCCCTGCCTGGGGTCCGG + Intergenic
991168629 5:63593999-63594021 TGATGCCTCTGCCTGGTGTCTGG - Intergenic
997296471 5:132771894-132771916 GGATGCTGCTACCCGGGGCCAGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001514800 5:172347925-172347947 CGAGGCAGCTGCCCTGGCTCTGG + Intronic
1003097982 6:3157270-3157292 CGAGGCCGCCGGGCGGGGTCCGG - Intronic
1006259071 6:32853463-32853485 CGCTGCCACTGCTCCGGGTCTGG - Exonic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1018911183 6:168101558-168101580 GGGTGACGCGGCCCGGGGTCCGG + Intergenic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1026892830 7:73992423-73992445 CGAGGCCGGTGCCCGAGGGCTGG + Intergenic
1029139657 7:98400908-98400930 CCCTCCCGCTGCCCGGAGTCCGG - Exonic
1029694569 7:102204399-102204421 CGCTGACGCTGCCCTGGGACAGG - Exonic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1037503228 8:19505510-19505532 CGATGCTGCTGGCCTGGGTCTGG - Exonic
1041107560 8:54457993-54458015 CGAAGCCGCCGCCCGTGTTCTGG - Exonic
1048360563 8:133694037-133694059 GGATGCCTCTGCCCTTGGTCTGG - Intergenic
1048956627 8:139542870-139542892 CCAAGCCCCTGCCCTGGGTCTGG - Intergenic
1049340130 8:142107733-142107755 CCCTGCTGCTGGCCGGGGTCAGG + Intergenic
1051894610 9:21974755-21974777 CACGGCCGCGGCCCGGGGTCGGG - Exonic
1057497596 9:95573087-95573109 CGGTGACGCTGCCTGGTGTCAGG + Intergenic
1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG + Intergenic
1059283089 9:113151163-113151185 CGCTGCCGCTGGCCCGGGGCTGG + Intronic
1060849103 9:126860428-126860450 CGACGCCGCTTCCCGGAGTCGGG + Intergenic
1061478810 9:130886246-130886268 CTCTGCTGCTGCCCGGGGTGGGG + Intronic
1062334052 9:136057135-136057157 CGTTGGCTCTGCCGGGGGTCTGG + Intronic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic