ID: 912487942

View in Genome Browser
Species Human (GRCh38)
Location 1:110043821-110043843
Sequence TTGCCCCAAAGGGCTCCCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912487933_912487942 11 Left 912487933 1:110043787-110043809 CCCCGCTACAGCACCCACAGACT 0: 1
1: 0
2: 0
3: 16
4: 107
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
912487938_912487942 -3 Left 912487938 1:110043801-110043823 CCACAGACTGACAGGCTGACTTG 0: 1
1: 0
2: 0
3: 17
4: 176
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
912487937_912487942 -2 Left 912487937 1:110043800-110043822 CCCACAGACTGACAGGCTGACTT 0: 1
1: 0
2: 1
3: 12
4: 159
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
912487931_912487942 15 Left 912487931 1:110043783-110043805 CCTCCCCCGCTACAGCACCCACA 0: 1
1: 0
2: 1
3: 35
4: 363
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
912487935_912487942 9 Left 912487935 1:110043789-110043811 CCGCTACAGCACCCACAGACTGA 0: 1
1: 0
2: 0
3: 17
4: 210
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
912487934_912487942 10 Left 912487934 1:110043788-110043810 CCCGCTACAGCACCCACAGACTG 0: 1
1: 0
2: 0
3: 14
4: 220
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80
912487932_912487942 12 Left 912487932 1:110043786-110043808 CCCCCGCTACAGCACCCACAGAC 0: 1
1: 0
2: 1
3: 5
4: 192
Right 912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912487942 Original CRISPR TTGCCCCAAAGGGCTCCCGT GGG Exonic