ID: 912489397

View in Genome Browser
Species Human (GRCh38)
Location 1:110053592-110053614
Sequence TCCCCATGGATTCACTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912489397_912489402 -6 Left 912489397 1:110053592-110053614 CCTGGCCAGTGAATCCATGGGGA 0: 1
1: 0
2: 0
3: 16
4: 107
Right 912489402 1:110053609-110053631 TGGGGAGCTGCTACAGGGCATGG 0: 1
1: 0
2: 2
3: 40
4: 393
912489397_912489403 4 Left 912489397 1:110053592-110053614 CCTGGCCAGTGAATCCATGGGGA 0: 1
1: 0
2: 0
3: 16
4: 107
Right 912489403 1:110053619-110053641 CTACAGGGCATGGCTCCTAACGG 0: 1
1: 0
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912489397 Original CRISPR TCCCCATGGATTCACTGGCC AGG (reversed) Intronic