ID: 912489446

View in Genome Browser
Species Human (GRCh38)
Location 1:110053849-110053871
Sequence TGACCTCTGGTTAGAAAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912489440_912489446 4 Left 912489440 1:110053822-110053844 CCTCCCTGAGGACTTTCAGATGA 0: 1
1: 0
2: 0
3: 25
4: 137
Right 912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 158
912489438_912489446 16 Left 912489438 1:110053810-110053832 CCAACGGGTGGACCTCCCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 158
912489437_912489446 22 Left 912489437 1:110053804-110053826 CCTGGGCCAACGGGTGGACCTCC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 158
912489442_912489446 0 Left 912489442 1:110053826-110053848 CCTGAGGACTTTCAGATGAACTA 0: 1
1: 0
2: 2
3: 12
4: 134
Right 912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 158
912489441_912489446 1 Left 912489441 1:110053825-110053847 CCCTGAGGACTTTCAGATGAACT 0: 1
1: 0
2: 3
3: 16
4: 165
Right 912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912489446 Original CRISPR TGACCTCTGGTTAGAAAGGG AGG Exonic
901013291 1:6212940-6212962 TGACCTCTAATTAAAGAGGGAGG - Intronic
901833981 1:11911861-11911883 TGACCTCTAGGGACAAAGGGTGG - Intergenic
902030101 1:13416093-13416115 TGAGCACTGGATAGAAAGGAAGG + Intronic
904664657 1:32110553-32110575 TGACCTCTAGAAAGAAGGGGTGG + Intronic
907235417 1:53041840-53041862 TTACCTCTAGTAAGAAGGGGTGG + Intronic
908736364 1:67281124-67281146 TTACCTCTGGGCAGAAAGGGAGG + Intergenic
910215913 1:84843983-84844005 AGACCTCTGGTAAGAAAGTGGGG - Intronic
911251275 1:95579293-95579315 TGAACTCTGGTGATAAAAGGAGG + Intergenic
912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG + Exonic
913463794 1:119117564-119117586 GGACCTCTGGTTAGCCAGGGTGG - Intronic
913563995 1:120052868-120052890 TGAACTCTGGTAAGAATGGAGGG - Intronic
913634130 1:120740697-120740719 TGAACTCTGGTAAGAATGGAGGG + Intergenic
914284584 1:146212216-146212238 TGAACTCTGGTAAGAATGGAGGG - Intronic
914545615 1:148662955-148662977 TGAACTCTGGTAAGAATGGAGGG - Intronic
914620948 1:149407711-149407733 TGAACTCTGGTAAGAATGGAGGG + Intergenic
916322829 1:163523621-163523643 TGAGAGATGGTTAGAAAGGGGGG - Intergenic
917922703 1:179764291-179764313 TGACATCTGGGCAGAAGGGGCGG + Intronic
921835317 1:219772375-219772397 TGACCCCTGGTTACCAAGCGAGG - Intronic
1065609053 10:27452700-27452722 TTACCTGAGGCTAGAAAGGGTGG - Intergenic
1070108490 10:73459782-73459804 TTACCTAGGGTTAGCAAGGGGGG + Intronic
1075203094 10:120422622-120422644 TGACCTCTGTAAAGAAAGCGTGG + Intergenic
1075331141 10:121574916-121574938 TGACAACTGGTTAGAAAGAGAGG - Intronic
1078725145 11:13923588-13923610 TGACCTCTGGGGAGAAGCGGAGG - Intergenic
1081827913 11:46076000-46076022 CTCCCTCTGGTTAGAAAGAGTGG - Intronic
1081993075 11:47347900-47347922 TGGCCTCTGGGTTCAAAGGGTGG + Exonic
1083099791 11:60291418-60291440 TGTGCTCTGATTAGAAAAGGAGG + Intronic
1088470993 11:110187454-110187476 TGATCTCTGCTCAGGAAGGGTGG - Intronic
1088604595 11:111515686-111515708 TGTCCTCTGGATAAACAGGGTGG - Intronic
1088707272 11:112475034-112475056 TGACCTCTGCTGGGAGAGGGTGG - Intergenic
1092258769 12:6941398-6941420 TGACATCGGGGCAGAAAGGGAGG - Exonic
1095400890 12:41813886-41813908 TGGCCTCTGCACAGAAAGGGTGG + Intergenic
1095779997 12:46048860-46048882 TGACCTCTGCACAGAAAGGGTGG - Intergenic
1097148273 12:56956870-56956892 TGACTTCTGCTTAGACAGGAGGG + Intronic
1098472520 12:70861971-70861993 TGACATCTGGTCAGAGAGTGAGG + Intronic
1099784263 12:87239975-87239997 TGGCCCCTGGTTAGGAAGGATGG + Intergenic
1100473843 12:94917547-94917569 TGGCCTGTGGGTTGAAAGGGGGG - Intronic
1101706723 12:107227432-107227454 TGACAGCTGGTTAGAAATGCAGG + Intergenic
1101848512 12:108383306-108383328 TGACCTCTGGTTAGAAATAGGGG - Intergenic
1101868216 12:108539413-108539435 TGACTTCTGGTTTGGAAGGGTGG - Intronic
1105235317 13:18546025-18546047 TAACCTTTGGTCAGAAAGGATGG - Intergenic
1107048470 13:36020671-36020693 TGACTTCTTGTTGGAAACGGTGG + Intronic
1107158531 13:37198132-37198154 AGATCTCTGCATAGAAAGGGTGG + Intergenic
1107726737 13:43306730-43306752 TGACCACTTGTTAAAAAGGAAGG - Intronic
1108436295 13:50404712-50404734 TGTCCTCTGATTGCAAAGGGTGG + Intronic
1110228148 13:73141278-73141300 TGAGCTCTGGATACAAATGGAGG - Intergenic
1112402850 13:99090407-99090429 TGACCTCTGGCTGGACTGGGTGG + Intergenic
1114480995 14:23034490-23034512 TTTGCTCTGGTTGGAAAGGGTGG - Intronic
1114596622 14:23917705-23917727 TGACCTCTGGAGAGGAAAGGAGG + Intergenic
1116114329 14:40628970-40628992 GGACCTCTGGTTAGCCAGGCAGG + Intergenic
1122048590 14:99040263-99040285 TGAGCTCTGGTAAGAGAGGCAGG - Intergenic
1122489053 14:102101256-102101278 TGGCCTCTGGTTAGACACAGTGG - Intronic
1122874976 14:104659765-104659787 TGACCACTGGTGAGAAAGGGAGG + Intergenic
1125328002 15:38556197-38556219 TGATCTCTGGTTAGAACAGAAGG + Intronic
1126831919 15:52616444-52616466 TGACCCCTGGTTGGAAGTGGTGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128226397 15:66004347-66004369 TGACCCCTGGGGAGAAAGAGAGG + Intronic
1128596247 15:68952913-68952935 TTACCGGTGGTTAGACAGGGAGG - Intronic
1129336958 15:74858119-74858141 TGAGCCCTGGCAAGAAAGGGAGG + Intronic
1130222395 15:82030799-82030821 TGCCCTCTGCTTAGTAAGGTTGG - Intergenic
1130808390 15:87351307-87351329 TAACCACTGGTTAGAAAGAATGG - Intergenic
1131919842 15:97313306-97313328 TGCTCCCTGGTTAGAATGGGTGG - Intergenic
1132825425 16:1902836-1902858 TGGACTCTGGTTGGGAAGGGGGG - Intergenic
1134129582 16:11640110-11640132 TGTCCTCTCAGTAGAAAGGGAGG + Intergenic
1138303189 16:55949611-55949633 TCACCTCTGGTTGGAAAGCTTGG - Intronic
1138319339 16:56098534-56098556 TGACCTGGGGATACAAAGGGAGG + Intergenic
1143754750 17:9058340-9058362 TGAGCTCTGTTTAAAAAGGCAGG - Intronic
1145838639 17:27974917-27974939 GGACCTCTGATGAGAAAGGGAGG - Intergenic
1145988238 17:29061939-29061961 CGACTGCTGGCTAGAAAGGGGGG + Intergenic
1146060126 17:29600572-29600594 TGTCCTGTGGTGAGGAAGGGGGG + Intronic
1148971065 17:51482247-51482269 TGACTTCTGTTTAGAAACAGTGG - Intergenic
1149650119 17:58271434-58271456 GGACCCCTGGTTGTAAAGGGTGG - Intronic
1150208524 17:63428014-63428036 TGACATTTGTTGAGAAAGGGGGG + Intergenic
1153045177 18:849314-849336 TGACATCTGGTGAGACAGGGAGG + Intergenic
1155815431 18:30302297-30302319 TGACCAACAGTTAGAAAGGGAGG - Intergenic
1156058077 18:33035188-33035210 TGACCTCTGGTTTGACAAGAGGG + Intronic
1157577936 18:48756068-48756090 GGTCCTCTGGCTAGAAAGAGTGG - Intronic
1158718662 18:59903105-59903127 TGACCTGTGATTAGACTGGGCGG + Exonic
1158839751 18:61372519-61372541 TGACCTCTGGTCAGAATTAGAGG - Intronic
1159894467 18:73983336-73983358 TTACTTCTGGATAGACAGGGAGG + Intergenic
1160188004 18:76690585-76690607 TTACCTCTAGTAAGAAAGGATGG + Intergenic
1160591522 18:79947552-79947574 TGGGCTCTGGTGAGAAGGGGCGG - Intronic
1161135770 19:2618759-2618781 TGCCCTGTGGTTACACAGGGTGG - Intronic
1164758715 19:30710738-30710760 TGACCTGTGGGCAGAAAGAGTGG - Intronic
1166040356 19:40198578-40198600 TGGCCTCTGGGGAGTAAGGGAGG + Intronic
1167117274 19:47495591-47495613 TGGCCTCTGGAGAGAAAGGGAGG + Exonic
925195030 2:1915834-1915856 TAACCTCTGGAAAGAAAGGGTGG + Intronic
927674906 2:25098126-25098148 TGACCTCAGCTCAGGAAGGGAGG - Intronic
932541649 2:72661227-72661249 TGTCCTCTGGCTAGAAAGGTGGG - Intronic
932594708 2:73086771-73086793 TGAGCTCTGGTGAGTAGGGGCGG + Intronic
935351827 2:102157539-102157561 TGACTTCTGGTTAGAAAATGGGG - Intronic
937484043 2:122295290-122295312 TTATGGCTGGTTAGAAAGGGAGG + Intergenic
939347525 2:140985946-140985968 TTACCTCTGGAAAGAGAGGGAGG - Intronic
942244127 2:173991509-173991531 AGACATCTGGGGAGAAAGGGGGG - Intergenic
942764781 2:179442141-179442163 TGATATCGGCTTAGAAAGGGGGG + Exonic
946292255 2:218754274-218754296 TAACGTCTGGGTAGAAAGGCTGG - Exonic
946639876 2:221772931-221772953 TGTGCTGTGGTTAGAAAGCGAGG + Intergenic
947726443 2:232404081-232404103 TTACCTCTGGGGAGAAAGGTGGG + Intergenic
1170757472 20:19217084-19217106 TGACATCTGGGTCGCAAGGGCGG + Intronic
1170806946 20:19640346-19640368 TGACCCCTGGTGAGGAAGGCTGG + Intronic
1172870892 20:38134948-38134970 TGGCCTCTGGCTGGAAAGTGAGG - Intronic
1176676644 21:9784752-9784774 TGACCTCTGTCTGGAAAGAGTGG + Intergenic
1176779312 21:13174308-13174330 TAACCTTTGGTCAGAAAGGATGG - Intergenic
1177680333 21:24359799-24359821 GGACCTCTGCTTGGGAAGGGAGG + Intergenic
1177977775 21:27872425-27872447 AGACCTCTGGCCAGGAAGGGTGG + Intergenic
1178530361 21:33370928-33370950 TGAGGTCTGGTTAGCAAAGGTGG - Intergenic
1179020052 21:37631733-37631755 GGTCCTCCGGTTAGAAAGGCAGG - Intronic
1180693953 22:17739996-17740018 AGAGCTCTGGTTGGAAAGGCAGG - Intronic
1185288932 22:50014536-50014558 TGACCTCAGGCTGGAGAGGGTGG - Intergenic
949682503 3:6530954-6530976 TGACCTATGGTTTGTAAGTGGGG + Intergenic
950145893 3:10649577-10649599 TGACCTCAGCTCAGGAAGGGAGG + Intronic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
955928543 3:64032202-64032224 TTACCTCGGGGTAAAAAGGGAGG - Intergenic
960297653 3:115963441-115963463 TGTACTCTGGTTATTAAGGGAGG + Intronic
960330422 3:116353102-116353124 TGACCTCTGGATAATCAGGGTGG + Intronic
960434719 3:117611736-117611758 TGACCTCTGGTTAGAAAATAGGG - Intergenic
962395691 3:135013722-135013744 TAGCCTCTGGTTACCAAGGGAGG - Intronic
962431836 3:135327327-135327349 TGCCATCAGGTTAGAAAAGGTGG - Intergenic
963940263 3:151090119-151090141 TAGCCTGTGGTTAGAAAGGTAGG + Intronic
966159265 3:176950779-176950801 TGACCTGTGATTAGATAGGCTGG - Intergenic
971033469 4:22666861-22666883 TGACCTCAGGAGAGAAAGGTAGG + Intergenic
972773462 4:42219707-42219729 TGAACTCACTTTAGAAAGGGAGG - Intergenic
972779573 4:42274868-42274890 TGAACTCTGTTTAGAAAGGTTGG + Intergenic
974775609 4:66476672-66476694 GGATCTCTGGTTAGGAAGGGTGG - Intergenic
977510188 4:97952788-97952810 GGACCTCTGGTTAGCCAGGTTGG + Intronic
978769375 4:112438198-112438220 AGACCTCTGGTAAGACAAGGGGG - Intronic
981421356 4:144554178-144554200 TCACCTCTGGTTGGGAAGGATGG - Intergenic
981558995 4:146026525-146026547 TTACCTTTGGTTAGAAGTGGTGG + Intergenic
982030499 4:151295683-151295705 TGCCCACTGATTAGAAAAGGAGG + Intronic
982220139 4:153117398-153117420 TCACTTCTGGATAGAAAGGAAGG - Intergenic
982555491 4:156857545-156857567 TGAGCTTTGGTAAGAAATGGGGG + Intronic
983316502 4:166139319-166139341 TCACCTGTGGTTTGAAAGAGAGG + Intergenic
985398893 4:189574016-189574038 TGACCTCTGTCTGGAAAGAGTGG - Intergenic
986374208 5:7113729-7113751 TGTCCCCAGGCTAGAAAGGGAGG - Intergenic
987441469 5:17961953-17961975 TGTGCTCTGGGTAGAGAGGGTGG + Intergenic
987778461 5:22400034-22400056 AGCTCTCTGGTTAGGAAGGGAGG - Intronic
988604148 5:32665949-32665971 TTGTCTCTGGTTAGAAAAGGAGG + Intergenic
989084808 5:37664685-37664707 TGAGATCTGTCTAGAAAGGGAGG - Intronic
993234742 5:85289941-85289963 TGATCTCTGGTGAGATAGGAAGG - Intergenic
993846090 5:92945464-92945486 TGGGCTTTGGTTAGAAGGGGTGG - Intergenic
994209409 5:97071739-97071761 GGAGCTCTTGTTATAAAGGGTGG + Intergenic
994382979 5:99093749-99093771 TAACTTCTGGTTTGAAAAGGTGG - Intergenic
995377828 5:111496721-111496743 TGCCCTTTGGTTAGAAAAGGAGG + Exonic
997804758 5:136906116-136906138 GGAACTCTGGTTAGAATGAGAGG - Intergenic
998878245 5:146621432-146621454 AGTCCTCTGACTAGAAAGGGTGG + Intronic
999396318 5:151231102-151231124 TGGACTCTGGATAGAAAGGCTGG + Intronic
999675077 5:153991423-153991445 TGCCTTCTGGTTACAAAGGCTGG - Exonic
1003210142 6:4055644-4055666 TGACATCTGCTGAGAAAGGCTGG - Intronic
1006191014 6:32209333-32209355 TTACCAGAGGTTAGAAAGGGTGG + Intronic
1007312255 6:40955747-40955769 TGCTCTCTGGTTACAAAGAGAGG - Intergenic
1007740417 6:44006337-44006359 TGACCTCTGGCTTGGATGGGTGG - Intergenic
1007779587 6:44245373-44245395 TGAGCTCTGCTTAGAAGGAGAGG + Intergenic
1011079938 6:83478869-83478891 TTACCTCTGGTGAAAAAGTGAGG + Intergenic
1013489524 6:110632311-110632333 AGACCTCTGGTTAAAAAGGGAGG - Intronic
1014835638 6:126157146-126157168 TGACCTCTGGGTAGGGAGGCAGG + Intergenic
1015000972 6:128214934-128214956 TGACCTCTAGCTATAAATGGGGG - Intronic
1018396432 6:163381321-163381343 TGACCTCTGGTCAGCTAAGGCGG - Intergenic
1018560690 6:165098479-165098501 TCATCTCTGGTTAGGAAGGGAGG - Intergenic
1020395639 7:7714113-7714135 TGTCCTGTGGTCAGAGAGGGTGG + Intronic
1022386597 7:29905202-29905224 TCAGCTGTGGTTAGAAAAGGGGG - Intronic
1023032158 7:36099217-36099239 TGTCCTCTGGTTAGAAAGCTAGG - Intergenic
1023732186 7:43202900-43202922 TGTCCTCTGGCTAGCAGGGGTGG - Intronic
1024284947 7:47748820-47748842 TGACCCCTGGACAGGAAGGGTGG + Intronic
1026296022 7:69053104-69053126 TGCACTGTGGGTAGAAAGGGAGG + Intergenic
1032404930 7:131649175-131649197 TGACCTGAGGCTAGAAAGGCAGG + Intergenic
1036165577 8:6429669-6429691 TGACCTCTGGTTAAATCTGGTGG - Intronic
1038444838 8:27596170-27596192 TGACATCTGTCTGGAAAGGGAGG - Intergenic
1041784060 8:61611769-61611791 TAAAGTCTGGTCAGAAAGGGTGG - Intronic
1043825582 8:84924532-84924554 TTATCTCTGGTGAGAAAGAGAGG + Intergenic
1046480257 8:114807847-114807869 TGACCATTGGTTAGAAGTGGTGG + Intergenic
1049619353 8:143591019-143591041 TGACCACTGTGTAGAAAGGAGGG + Intronic
1051896446 9:21994372-21994394 TCACCTCTGGTGCCAAAGGGCGG - Intronic
1056749672 9:89338930-89338952 AGACTTCTGGATAGAAAAGGAGG - Intronic
1058784517 9:108374261-108374283 GGACCTCTGGTTAGCCAGGGTGG + Intergenic
1058861117 9:109118987-109119009 TTACTTCTGGTTGGAGAGGGCGG - Intronic
1060236478 9:121867144-121867166 TGACCTCTGGTATGAGAGGAAGG - Intronic
1060822251 9:126668222-126668244 ATCCCTCTGGTTGGAAAGGGTGG + Intronic
1061222792 9:129262040-129262062 TGTCCTCTGGACAGCAAGGGAGG - Intergenic
1189192721 X:39124473-39124495 TGATCTCAGGTTAAAAAGGAGGG - Intergenic
1192092433 X:68174234-68174256 TTGCCTCTTGTTATAAAGGGTGG - Intronic
1193903633 X:87216217-87216239 TGCCCTCTGCTTACACAGGGAGG - Intergenic
1197031707 X:121824072-121824094 GGATCTCTGCATAGAAAGGGTGG - Intergenic