ID: 912492697

View in Genome Browser
Species Human (GRCh38)
Location 1:110070701-110070723
Sequence GCGCGGGGGCGCGGAGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 497}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912492677_912492697 18 Left 912492677 1:110070660-110070682 CCGCGCCGCCTGTGAGCGCCCGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497
912492676_912492697 19 Left 912492676 1:110070659-110070681 CCCGCGCCGCCTGTGAGCGCCCG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497
912492690_912492697 -4 Left 912492690 1:110070682-110070704 CCAAGGGGGAGGGACCTGGGCGC 0: 1
1: 0
2: 2
3: 22
4: 240
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497
912492678_912492697 13 Left 912492678 1:110070665-110070687 CCGCCTGTGAGCGCCCGCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497
912492686_912492697 0 Left 912492686 1:110070678-110070700 CCCGCCAAGGGGGAGGGACCTGG 0: 1
1: 0
2: 2
3: 41
4: 393
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497
912492688_912492697 -1 Left 912492688 1:110070679-110070701 CCGCCAAGGGGGAGGGACCTGGG 0: 1
1: 0
2: 5
3: 29
4: 279
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497
912492682_912492697 10 Left 912492682 1:110070668-110070690 CCTGTGAGCGCCCGCCAAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG 0: 1
1: 1
2: 6
3: 59
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912492697 Original CRISPR GCGCGGGGGCGCGGAGCCCC CGG Intronic