ID: 912495347

View in Genome Browser
Species Human (GRCh38)
Location 1:110088173-110088195
Sequence CCCCAAAGACGGGCGTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912495342_912495347 0 Left 912495342 1:110088150-110088172 CCTAATGATATCTCAAAGCCAGA No data
Right 912495347 1:110088173-110088195 CCCCAAAGACGGGCGTCCACTGG No data
912495339_912495347 22 Left 912495339 1:110088128-110088150 CCAGAACACTCAGGAATCCCATC No data
Right 912495347 1:110088173-110088195 CCCCAAAGACGGGCGTCCACTGG No data
912495341_912495347 4 Left 912495341 1:110088146-110088168 CCATCCTAATGATATCTCAAAGC No data
Right 912495347 1:110088173-110088195 CCCCAAAGACGGGCGTCCACTGG No data
912495340_912495347 5 Left 912495340 1:110088145-110088167 CCCATCCTAATGATATCTCAAAG No data
Right 912495347 1:110088173-110088195 CCCCAAAGACGGGCGTCCACTGG No data
912495338_912495347 23 Left 912495338 1:110088127-110088149 CCCAGAACACTCAGGAATCCCAT No data
Right 912495347 1:110088173-110088195 CCCCAAAGACGGGCGTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912495347 Original CRISPR CCCCAAAGACGGGCGTCCAC TGG Intergenic
No off target data available for this crispr