ID: 912495545

View in Genome Browser
Species Human (GRCh38)
Location 1:110089139-110089161
Sequence CACCTAAGACTGTTGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912495535_912495545 28 Left 912495535 1:110089088-110089110 CCCCACACGGGTGCTCTCATCTG No data
Right 912495545 1:110089139-110089161 CACCTAAGACTGTTGAGGGAGGG No data
912495536_912495545 27 Left 912495536 1:110089089-110089111 CCCACACGGGTGCTCTCATCTGA No data
Right 912495545 1:110089139-110089161 CACCTAAGACTGTTGAGGGAGGG No data
912495537_912495545 26 Left 912495537 1:110089090-110089112 CCACACGGGTGCTCTCATCTGAC No data
Right 912495545 1:110089139-110089161 CACCTAAGACTGTTGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912495545 Original CRISPR CACCTAAGACTGTTGAGGGA GGG Intergenic
No off target data available for this crispr