ID: 912495730

View in Genome Browser
Species Human (GRCh38)
Location 1:110089948-110089970
Sequence GGCCATAGCCCTTGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912495717_912495730 26 Left 912495717 1:110089899-110089921 CCAGCCCGAAGCTTTAGGTGGGA No data
Right 912495730 1:110089948-110089970 GGCCATAGCCCTTGGGAGATGGG No data
912495720_912495730 21 Left 912495720 1:110089904-110089926 CCGAAGCTTTAGGTGGGAGAGGA No data
Right 912495730 1:110089948-110089970 GGCCATAGCCCTTGGGAGATGGG No data
912495718_912495730 22 Left 912495718 1:110089903-110089925 CCCGAAGCTTTAGGTGGGAGAGG No data
Right 912495730 1:110089948-110089970 GGCCATAGCCCTTGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912495730 Original CRISPR GGCCATAGCCCTTGGGAGAT GGG Intergenic
No off target data available for this crispr