ID: 912497583

View in Genome Browser
Species Human (GRCh38)
Location 1:110101515-110101537
Sequence CTGCATCCTGCCTGGCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497583_912497591 -5 Left 912497583 1:110101515-110101537 CCCCGGAGCCAGGCAGGATGCAG No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497583_912497598 27 Left 912497583 1:110101515-110101537 CCCCGGAGCCAGGCAGGATGCAG No data
Right 912497598 1:110101565-110101587 ACCCTCGCTCTGCCCTGCCAGGG No data
912497583_912497597 26 Left 912497583 1:110101515-110101537 CCCCGGAGCCAGGCAGGATGCAG No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497583 Original CRISPR CTGCATCCTGCCTGGCTCCG GGG (reversed) Intergenic